View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18178_low_87 (Length: 330)
Name: NF18178_low_87
Description: NF18178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18178_low_87 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 16 - 315
Target Start/End: Original strand, 18468508 - 18468807
Alignment:
| Q |
16 |
cactcatcgcaccactaggaaggccgccattacatatctaagaaggagtttggaaatagggagggttgtggcggcgataagcctttagagagggttcaaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
18468508 |
cactcatcgcaccactaggaaggccgccattacatatctaagaaggagtttggaaatagggagggttgtggcggcgagaagcttttagagagggttcaaa |
18468607 |
T |
 |
| Q |
116 |
tccccaattttcacccattgagctaacttttgggggttgagtttcctttagtttgtcaccatcaacccttaaatttgaacacctttatatttcatacatt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18468608 |
tccccaattttcacccattgagctaacttttgggggttgagtttcctttagtttgtcaccatcaacccttaaatttgaacacctttatatttcatacatt |
18468707 |
T |
 |
| Q |
216 |
catttaacacactattttctctatgtccctctccttctatcacattatcctctctctatctctgtgtctttcaaggtgtagatgagttctaggtttctac |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18468708 |
catttaacacactattttctctatgtccctctctttctatcacattatcctctctctatctctgtgtctttcaaggtgtagatgagttctaggtttctac |
18468807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University