View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18179_high_12 (Length: 347)

Name: NF18179_high_12
Description: NF18179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18179_high_12
NF18179_high_12
[»] chr8 (1 HSPs)
chr8 (57-296)||(39887614-39887840)


Alignment Details
Target: chr8 (Bit Score: 175; Significance: 4e-94; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 175; E-Value: 4e-94
Query Start/End: Original strand, 57 - 296
Target Start/End: Complemental strand, 39887840 - 39887614
Alignment:
57 tgtgtaatgaatgtagtatgggggtagaagtagatagataataaatgcaaagaaatgattgggcaatgagtaggatgaaaactaatggcacatgaatggc 156  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
39887840 tgtgtaatgaatgtagtatgggggtagaagtagatagataataaatgcaaagaaatgattgggcaatgagtaggatgaaaactgatggcacatgaatggc 39887741  T
157 aagtagcaagtgattagtatgatcatgtggagtggagtggagagggtctgacaacattgcgcgtagattgataaaaacaatgtagtagtaattaattaat 256  Q
    ||||||||||||||| ||||||||||     | |||| ||||||||||||||||||||||||||||||||||||||||||||||||||        ||||    
39887740 aagtagcaagtgatttgtatgatcat-----ggggagaggagagggtctgacaacattgcgcgtagattgataaaaacaatgtagtag--------taat 39887654  T
257 taattaatgtggtagaatgtaactcatactactacgtaca 296  Q
    ||||||||||||||||||||||||||||||||||||||||    
39887653 taattaatgtggtagaatgtaactcatactactacgtaca 39887614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University