View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18179_high_19 (Length: 266)
Name: NF18179_high_19
Description: NF18179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18179_high_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 19 - 250
Target Start/End: Complemental strand, 33894651 - 33894420
Alignment:
| Q |
19 |
tgtttggtcattttggaatatcaccacagtctcaacaacaacaatggaaccatcttgtctctagatcacaccctcaaacccaattccatggtcaatttca |
118 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33894651 |
tgtttggtccttttggaatatcaccacagtctcaacaacaacaatggaaccatcttgtctctagatcacaccctcaaacccaattccatggtcaatttca |
33894552 |
T |
 |
| Q |
119 |
gttttcagaaccacaattacatcctcagggttttgcacaagctcactatgcacagttgcagtctcaggcagcacttgcttctttacaatcatcacaaact |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33894551 |
gttttcagaaccacaattacatcctcagggttttgcacaagctcactatgcacagttgcagtctcaggcagcacttgcttctttacaatcatcacaaact |
33894452 |
T |
 |
| Q |
219 |
caacctgttactccattgcataatgccaatac |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
33894451 |
caacctgttactccattgcataatgccaatac |
33894420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University