View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18179_low_18 (Length: 298)
Name: NF18179_low_18
Description: NF18179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18179_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 33 - 279
Target Start/End: Complemental strand, 230408 - 230162
Alignment:
| Q |
33 |
aagatgggcacacatcatatagttttggtggtaattggtttgatctgcgttgtgttttccagcgtaggagcccaacaagctccatccacctccccaaact |
132 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
230408 |
aagatgggcacacatcatatagttttggttgtaattggtttgatctgcgttgtgttttccagcgtaggagcccaacaagctccatccacctccccaaact |
230309 |
T |
 |
| Q |
133 |
catctccagcaccacccactcctccttctaatacacccccaaccactcctcaagcctcccctccacctgttcaatcttctcctccacccgtccagtcttc |
232 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
230308 |
catctccagcaccacccactcctcctgctaatacacccccaaccactcctcaagcctcccctccacctgttcaatcttctcctccacccgtccagtcttc |
230209 |
T |
 |
| Q |
233 |
tccacctcctcttcagtcctcccctccaccagctcagtccactcccc |
279 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
230208 |
tccacctcctcttcagtcatcccctccaccagctcagtccactcccc |
230162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University