View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18179_low_19 (Length: 288)
Name: NF18179_low_19
Description: NF18179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18179_low_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 82 - 273
Target Start/End: Complemental strand, 19644090 - 19643899
Alignment:
| Q |
82 |
aatggcaaatatatataaagaagatacggaagatacaatgtacaaaggatgaaaatgattgtctaatggacaaaattagacaatgaatttgaaggaaaaa |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19644090 |
aatggcaaatatatataaagaagatacggaagatacaatgtacaaaggatgaaaatgattgtctaatggacaaaattagacaatgaatttgaaggaaaaa |
19643991 |
T |
|
| Q |
182 |
tgataatatgaaaggttagcaacaatgaacaaacagtaaatagatatatttgttatggcctttgcaagaatagtaaacaaacccgttgattt |
273 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19643990 |
taataatatgaaaggttagcaacaatgaacaaacagtaaatagatatatttgttatggcctttgcaagaatagtaaacaaacccgttgattt |
19643899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University