View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18179_low_26 (Length: 243)
Name: NF18179_low_26
Description: NF18179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18179_low_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 3 - 102
Target Start/End: Complemental strand, 34070766 - 34070667
Alignment:
| Q |
3 |
ttgggtcaaaatcaactcataatcagtcttgatccctggattaagtatattttgtatttaatttgatctttatataatataatgtagttgatgttcaaat |
102 |
Q |
| |
|
||||||||| ||||||||||||||||||||| || |||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
34070766 |
ttgggtcaagatcaactcataatcagtcttggtctctggattaagtaaattttgtatttaatttgatctttatataatataatgtacttgatgttcaaat |
34070667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 166 - 223
Target Start/End: Complemental strand, 34070603 - 34070546
Alignment:
| Q |
166 |
gctgacatacatgtgttttttgggagaagatgatcnnnnnnntagagcatgcatatga |
223 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34070603 |
gctgacatacatgttttttttgggagaagatgatcaaaaaaatagagcatgcatatga |
34070546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University