View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18180_high_3 (Length: 392)
Name: NF18180_high_3
Description: NF18180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18180_high_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 339; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 10 - 364
Target Start/End: Complemental strand, 8188456 - 8188102
Alignment:
| Q |
10 |
agcaactcctgaagctctaactcaacgtctgcatcattatcctcatcctcatcaaggttttcattttcatgagatgaaagaccgtcacgttctccaccct |
109 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8188456 |
agcaactcctgaagctctaactcaaagtctgcatcattatcctcatcatcatcaaggttttcattttcatgagatgaaagaccgtcacgttctccaccct |
8188357 |
T |
 |
| Q |
110 |
gtaatacagctgctagaaattttttatactcttcttcatcatcgacattttgaacatcatcttcatcatcggtctcttgaagaaaggtctcaagctcatc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8188356 |
gtaatacagctgctagaaattttttatactcttcttcatcatcgacattttgaacatcatcttcatcatcagtctcttgaagaaaggtctcaagctcatc |
8188257 |
T |
 |
| Q |
210 |
aagactgaaaccttcaagcgaataacgagctctagtacgcatacaaatagcatcctcagtatctatgtctatcactgggcttcggggtttcgttgtgttg |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8188256 |
aagactgaaaccttcaagcgaataacgagctctagtacgcatacaaatagcatcctcagtatctatgtctatcactgggcttcggggtttcgttgtgttg |
8188157 |
T |
 |
| Q |
310 |
cttatgtcttctatcctaaaaccatcactagtaccactaatcgagtcattcttct |
364 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
8188156 |
cttatgtcttctatcctaaaaccatcactagtaccactaatcaagtcattcttct |
8188102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University