View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18181_high_7 (Length: 277)
Name: NF18181_high_7
Description: NF18181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18181_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 9e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 9e-79
Query Start/End: Original strand, 1 - 157
Target Start/End: Complemental strand, 36800640 - 36800484
Alignment:
| Q |
1 |
tgttccttcttctgtggaaccaaacatgctccccaagtccaccatgattcctgcaacttcttggtttacacctaaaaggtaatttctcttttcaccccct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36800640 |
tgttccttcttctgtggaaccaaacatgctccccaagtccaccatgattcctgcaacttcttggtttacacctaaaaggtaatttctcttttcaccccct |
36800541 |
T |
 |
| Q |
101 |
cttttgttgatagatccgttttgaataaaaaagcattgaaaagcaaggaaattttga |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36800540 |
tttttgttgatagatccgttttgaataaaaaaacattgaaaagcaaggaaattttga |
36800484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University