View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18181_low_12 (Length: 221)
Name: NF18181_low_12
Description: NF18181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18181_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 66; Significance: 2e-29; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 22 - 95
Target Start/End: Complemental strand, 10254732 - 10254659
Alignment:
| Q |
22 |
tctatgaaggtgttgatgatgtcgtcaaatgtgttgaatagtagtgctgggagtgacgatgtttgtcgtttttt |
95 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10254732 |
tctatgaaggtgttgatgatgtcgtcgaatgtgttgaatagtagtgctgggagtgacgatgtttgtggtttttt |
10254659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 22 - 87
Target Start/End: Original strand, 10239873 - 10239938
Alignment:
| Q |
22 |
tctatgaaggtgttgatgatgtcgtcaaatgtgttgaatagtagtgctgggagtgacgatgtttgt |
87 |
Q |
| |
|
||||||||||||||||||||||| || | |||||||| || |||||||| || ||| ||||||||| |
|
|
| T |
10239873 |
tctatgaaggtgttgatgatgtcatcgagtgtgttgagtattagtgctgagattgatgatgtttgt |
10239938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University