View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18181_low_7 (Length: 336)
Name: NF18181_low_7
Description: NF18181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18181_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 318
Target Start/End: Complemental strand, 40173451 - 40173134
Alignment:
| Q |
1 |
agcaatcatcatgcaggtaacaccaagcagttgtaactgctgtgtgttcattgctttgcctgaaagatagcgatcaaggtagttaactgccaaaaatagt |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40173451 |
agcaatcatcatgcaggtaacaccaagtagttgtaactgctgcgtgttcattgctttgcctgaaagatagcgatcaaggtagttaactgccaaaaatagt |
40173352 |
T |
 |
| Q |
101 |
gtatcaggtagaagtctgtactcgtcagcaacctacaatggagagagaaattaagtgaaaaccatttgaaaggaaactcaatgaaggatactgttcttct |
200 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| ||||||| |
|
|
| T |
40173351 |
gtatcaggtaggagtctgtactcgtcagcaacctacaatggagagagaaattaagtgaaaaccatttgaaaagaaacttaatgaaggatacaattcttct |
40173252 |
T |
 |
| Q |
201 |
ggttttccctcatgagtnnnnnnnnnnnnnnngcaagttcactgaatcctatacaaataacaatgaatcctacttccattgctatggcatctttacctct |
300 |
Q |
| |
|
||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40173251 |
ggtgttccctcatgaggaaaaaagagaaaaaagcaagttcactgaatcctatacaaataacaatgaatcctacttccattgctatggcatctttacctct |
40173152 |
T |
 |
| Q |
301 |
cctaacatgagtatttaa |
318 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
40173151 |
cctaacatgagtatttaa |
40173134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University