View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18182_high_12 (Length: 211)
Name: NF18182_high_12
Description: NF18182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18182_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 23 - 191
Target Start/End: Original strand, 28034675 - 28034838
Alignment:
| Q |
23 |
caacttgtatcatttattgattgcaataataaagcgttacaagataatttgattaggctgcttagccaaaaatgctatgaattctaacatgggaagatgg |
122 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28034675 |
caacttgtatcatttattgattgcaataa----gcattacaagataatttgattaggctgcttagccaaaaatgctatcaattctaacatgggaagatgg |
28034770 |
T |
 |
| Q |
123 |
gtttggtgcctgatataactcccacattaacaaaaaatgccccacaatattttatcactacgtttactt |
191 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28034771 |
acttggtg-ctgatataattcccacattaacaaaaaatgccccacaatattttaacactacgtttactt |
28034838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 77
Target Start/End: Original strand, 1357158 - 1357205
Alignment:
| Q |
27 |
ttgtatcatttattgattgcaataataaagcgttacaagataatttgatta |
77 |
Q |
| |
|
|||||||||||||||||||| ||| |||| ||||||||||||||||||| |
|
|
| T |
1357158 |
ttgtatcatttattgattgc---aatgaagcattacaagataatttgatta |
1357205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University