View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18182_high_15 (Length: 202)

Name: NF18182_high_15
Description: NF18182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18182_high_15
NF18182_high_15
[»] chr1 (1 HSPs)
chr1 (91-202)||(51386692-51386803)


Alignment Details
Target: chr1 (Bit Score: 112; Significance: 8e-57; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 91 - 202
Target Start/End: Original strand, 51386692 - 51386803
Alignment:
91 catgatccacacaacaacgattgagatggagaataaattttgtaccttgtgagcttttaaattaggagatggagaagaaagggtaaaccaaaggagaaga 190  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51386692 catgatccacacaacaacgattgagatggagaataaattttgtaccttgtgagcttttaaattaggagatggagaagaaagggtaaaccaaaggagaaga 51386791  T
191 aagaatgtaaat 202  Q
    ||||||||||||    
51386792 aagaatgtaaat 51386803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University