View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18182_high_15 (Length: 202)
Name: NF18182_high_15
Description: NF18182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18182_high_15 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 112; Significance: 8e-57; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 91 - 202
Target Start/End: Original strand, 51386692 - 51386803
Alignment:
| Q |
91 |
catgatccacacaacaacgattgagatggagaataaattttgtaccttgtgagcttttaaattaggagatggagaagaaagggtaaaccaaaggagaaga |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51386692 |
catgatccacacaacaacgattgagatggagaataaattttgtaccttgtgagcttttaaattaggagatggagaagaaagggtaaaccaaaggagaaga |
51386791 |
T |
 |
| Q |
191 |
aagaatgtaaat |
202 |
Q |
| |
|
|||||||||||| |
|
|
| T |
51386792 |
aagaatgtaaat |
51386803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University