View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18182_low_12 (Length: 276)
Name: NF18182_low_12
Description: NF18182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18182_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 18 - 270
Target Start/End: Complemental strand, 34444811 - 34444562
Alignment:
| Q |
18 |
gcatgtctgttgcttgggctagattctcacataggatagagtatcactatgaaatatgaatcagtaatgtactgttatggagctatcgaataggttcgct |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| || |
|
|
| T |
34444811 |
gcatgtctgttgcttgggctagattctcacataggatagagtatcactatgaaatatgaatcagtaatgtactgttatggagctatcaaataggttctct |
34444712 |
T |
 |
| Q |
118 |
tgttagttgttgtgactgaatatttcattggattcatgatatctatctaaagtggtgctttccaaacataaatagtagtactgttttgtattcagtacgt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
34444711 |
tgttagttgttgtgactgaatatttcattggattcatgatatctatctaaagtggtgctttccaaacataaat---agtattgttttgtattcagtacgt |
34444615 |
T |
 |
| Q |
218 |
tgggaaaggtgcctgccatgtcttagtacttttcaggaataattctctttgtc |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34444614 |
tgggaaaggtgcctgccatgtcttagtacttttcaggaataattctctttgtc |
34444562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 18 - 114
Target Start/End: Complemental strand, 4456987 - 4456891
Alignment:
| Q |
18 |
gcatgtctgttgcttgggctagattctcacataggatagagtatcactatgaaatatgaatcagtaatgtactgttatggagctatcgaataggttc |
114 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
4456987 |
gcatgactgttgcttaggctagattctcacatagaatagagtatcactatgaaatatgaatcagcaatgtactgttatggagctatcaaataggttc |
4456891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University