View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18182_low_18 (Length: 209)
Name: NF18182_low_18
Description: NF18182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18182_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 60 - 192
Target Start/End: Original strand, 35918383 - 35918515
Alignment:
| Q |
60 |
gttcatggcgcgaattcttctccctctcctccctctcccgtccctactcctacgacgacgcaatgctccgtctccgtcataacctaacctactttcaatt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35918383 |
gttcatggcgcgaattcttctccctctcctccctctcccgtccctactcctacgacgacgcaatgctccgtctccgtcataacctaacctactttcaatt |
35918482 |
T |
 |
| Q |
160 |
caactacaccaccacaatcctcctcatcgtctt |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
35918483 |
caactacaccaccacaatcctcctcatcgtctt |
35918515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University