View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18185_low_14 (Length: 227)
Name: NF18185_low_14
Description: NF18185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18185_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 69 - 212
Target Start/End: Complemental strand, 700319 - 700176
Alignment:
| Q |
69 |
gtctcaaattccatcgtgaacaaattccttgcaaacaaagcatcacaccaccttcccacatgtaatgccatgaaccatgctttgaaagcatatgcaccgt |
168 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
700319 |
gtctcaaattccatcgtgagcaaattccttgcaaacaaagcatcacaccaccttcccacatgtaatgccatgaaccatgctttgaaagcatatgcaccgt |
700220 |
T |
 |
| Q |
169 |
tgagattgggtccaaatatctgacaagtaaccggacacaataac |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
700219 |
tgagattgggtccaaatatctgacaagtaaccggacacaataac |
700176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 700387 - 700349
Alignment:
| Q |
1 |
aaagagtcttagattcagtttcatatcgatcaaacgact |
39 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
700387 |
aaagagtcttagattcagtttcatatcgatcaaacgact |
700349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University