View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18185_low_8 (Length: 361)
Name: NF18185_low_8
Description: NF18185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18185_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 184 - 338
Target Start/End: Complemental strand, 1855833 - 1855679
Alignment:
| Q |
184 |
gtgtgctataacctgtattgtatatgtggnnnnnnnnnttgggtattcgatcatccaaccccttcaaaatatgggatcttatcggaagctagttttcgat |
283 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1855833 |
gtgtgttataacctgtattgtatatgtggaaaaaaaaattgggtattcgatcatccaaccccttcaaaatatgggatcttatcggaagctagttttcgat |
1855734 |
T |
 |
| Q |
284 |
agtgtattagaatatgatattcaaaattagttttttatagtatattttgagatat |
338 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
1855733 |
agtgtattagaatacgatattcaaaattagtttttcatagtattttttgagatat |
1855679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 1 - 90
Target Start/End: Complemental strand, 1856069 - 1855976
Alignment:
| Q |
1 |
ttattcccaaaatttaagagtgtaacataagcaccactcagaaaagagtgtagtgaaagcaataa------taatgaattgaaatcattgtcgacg |
90 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1856069 |
ttattcccaaaatttaag--tgtaacataagcaccactcagaaaagagtgtagtgaaagcaataataataataatgaattgaaatcattgtcgacg |
1855976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University