View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18186_low_7 (Length: 284)
Name: NF18186_low_7
Description: NF18186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18186_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 11 - 268
Target Start/End: Complemental strand, 16457674 - 16457417
Alignment:
| Q |
11 |
atgaaacaggttgatttaactggaaatacctttggcctattagctgcacatccagtaacacccttactgtctctgcatcatccagattacacagatccga |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||| | |
|
|
| T |
16457674 |
atgaaacaggttgatttaactggaaatacctttggcttattagctgcacacccagtaacacccttattgtctctgcatcatccagattacacagatccaa |
16457575 |
T |
 |
| Q |
111 |
tctttccaaacatgacaactacaaaagctctaaaacatttatttgaagcagtaaatgttgattctcaaaggatgttgcaacaaacaatttgctatgacag |
210 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| || |
|
|
| T |
16457574 |
tctttccgaacatgacaactacacaagctctaaaacatttatttgaagcagtaaatgttgattctcaaaggatgttgcaacaaacaatctgctatgatag |
16457475 |
T |
 |
| Q |
211 |
atggttttcatggacaatttcagtgtcatggggttatgctgttcaagtattccccaac |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16457474 |
atggttttcatggacaatttcagtgtcatggggttatgctgttcaagtattccccaac |
16457417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 62; Significance: 8e-27; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 146 - 263
Target Start/End: Complemental strand, 37514503 - 37514386
Alignment:
| Q |
146 |
catttatttgaagcagtaaatgttgattctcaaaggatgttgcaacaaacaatttgctatgacagatggttttcatggacaatttcagtgtcatggggtt |
245 |
Q |
| |
|
|||||||||||||| | | |||||||||| ||||| ||| | |||||||| ||||||| || ||| |||||||| |||||||||||||||||||||| | |
|
|
| T |
37514503 |
catttatttgaagctgcatatgttgattcacaaagaatgctacaacaaactgtttgctacgatagacggttttcacggacaatttcagtgtcatggggat |
37514404 |
T |
 |
| Q |
246 |
atgctgttcaagtattcc |
263 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
37514403 |
atgctgttcaagtattcc |
37514386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University