View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18187_high_21 (Length: 228)
Name: NF18187_high_21
Description: NF18187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18187_high_21 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 66 - 228
Target Start/End: Complemental strand, 19967934 - 19967772
Alignment:
| Q |
66 |
agttacaatatatccaaatttatgtatcatatcatttttacatgttagtgtctaaaattgaaatacaaaacaaaagtagatcttacaaagtactcatatg |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19967934 |
agttacaatatatccaaatttatgtatcatatcatttttacatgttagtgtctaaaattgaaatacaaaacaaaagtagatcttacaaagtactcatatg |
19967835 |
T |
|
| Q |
166 |
tccagaaatgtaatgtaatgaaataaccctgacatcttcgataacatgcaaaaaaccttcttc |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19967834 |
tccagaaatgtaatgtaatgaaataaccctgacatcttcgataacatgcaaaaaaccttcttc |
19967772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University