View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18187_low_12 (Length: 326)
Name: NF18187_low_12
Description: NF18187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18187_low_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 22 - 309
Target Start/End: Original strand, 10383195 - 10383482
Alignment:
| Q |
22 |
aaggcggcagccacaaccaacaactctgccgtcgttggtgcctccgacgaaggctggctatggtcacaaatcaaagccgaagcacgccgcgacgcggaat |
121 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10383195 |
aaggcggcagccaccaccaacaactccgccgtcgttggtgcctccgacgaaggctggctatggtcacaaatcaaagccgaagcacgccgcgacgcggaat |
10383294 |
T |
|
| Q |
122 |
cggaaccagcactagcaagctacctatactcaacaattctctctcactcttcactcgaacgttcactttcgtttcatcttggtaacaagctttgttcttc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10383295 |
cggaaccagcactagcaagctacctatactcaacaattctctctcactcttcactcgaacgttcactttcgtttcatcttggtaacaagctttgttcttc |
10383394 |
T |
|
| Q |
222 |
gacgcttctttcgacgcttctttatgacctttttcttaacgcttttgcgactgatccgtcgctaagttctgctgctgttgctgatctt |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10383395 |
gacgcttctttcgacgcttctttatgacctttttcttaacgcttttgcgactgatccgtcgctaagttctgctgctgttgctgatctt |
10383482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University