View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18187_low_16 (Length: 297)
Name: NF18187_low_16
Description: NF18187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18187_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 13 - 280
Target Start/End: Complemental strand, 26437531 - 26437271
Alignment:
| Q |
13 |
tgaatatgtgtaaatagtcacatggctcacattgcatcacatgcatggtcgggctttagaggatgattgtggatttgagttgttgaaccgacatttgatt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
26437531 |
tgaatatgtgtaaatagtcacatggctcacattgcgtcacatgcatggtcgggctttagaggatgattgtggatttgagttgttgaaccaacatttgatt |
26437432 |
T |
 |
| Q |
113 |
tgttccatttggaccgctatgtcaagcaacggtcttcaacaatgtaaaactttcagaagtttctttgtaaatatttgaattt--gaagcctccatggacc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
26437431 |
tgttccatttggaccgctatgtcaagcaatggtcttcaacaatgtaaaac---------tttctttgtaaatatttgaatttgagaagcctccatggacc |
26437341 |
T |
 |
| Q |
211 |
aaactctcttaaattttactaaaaccttagctatacagtttttatcaataactaatatggatctcactcc |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26437340 |
aaactctcttaaattttactaaaaccttagctatacagtttttatcaataactaatatggatctcactcc |
26437271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University