View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18188_high_14 (Length: 204)
Name: NF18188_high_14
Description: NF18188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18188_high_14 |
 | |
|
| [»] scaffold0110 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0110 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: scaffold0110
Description:
Target: scaffold0110; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 9 - 109
Target Start/End: Original strand, 41439 - 41539
Alignment:
| Q |
9 |
ttcaggttatttctctgtgcaaattgcaatcagcttcccagagccttatcctgtctactacacttcctgcagctcctgagtttaactgaaacttactcca |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
41439 |
ttcaggttatttctctgtgcaaattgcaatcagcttcccagtgccttatcatgtctactacacctcctgcagctcctgagtttaactggaacttactcca |
41538 |
T |
|
| Q |
109 |
t |
109 |
Q |
| |
|
| |
|
|
| T |
41539 |
t |
41539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 30036340 - 30036227
Alignment:
| Q |
1 |
cagtttaattcaggttatttctctgtgcaaattgcaatcagcttcccagagccttatcctgtctactacact-----tcctgcagctcctgagtttaact |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||| ||||||||||||||| |
|
|
| T |
30036340 |
cagtttaattcaggttatttctctgtgcaaattgcaatcagcttcccagtgccttatcctgtctactacactacatctcatgcaactcctgagtttaact |
30036241 |
T |
|
| Q |
96 |
gaaacttactccat |
109 |
Q |
| |
|
|||||||||||| |
|
|
| T |
30036240 |
agaacttactccat |
30036227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 30152076 - 30151963
Alignment:
| Q |
1 |
cagtttaattcaggttatttctctgtgcaaattgcaatcagcttcccagagccttatcctgtctactacact-----tcctgcagctcctgagtttaact |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||| ||||||||||||||| |
|
|
| T |
30152076 |
cagtttaattcaggttatttctctgtgcaaattgcaatcagcttcccagtgccttatcctgtctactacactacatctcatgcaactcctgagtttaact |
30151977 |
T |
|
| Q |
96 |
gaaacttactccat |
109 |
Q |
| |
|
|||||||||||| |
|
|
| T |
30151976 |
agaacttactccat |
30151963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University