View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18188_low_11 (Length: 244)
Name: NF18188_low_11
Description: NF18188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18188_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 15 - 227
Target Start/End: Complemental strand, 47423797 - 47423585
Alignment:
| Q |
15 |
cacagacgaacgaaagcaaatgaacattgacgatgtgatgacaaaaacagctagtgacaaccacagtcatggattcatcactggtgaagtcatttgcgct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47423797 |
cacagacgaacgaaagcaaatgaacattgacgatgtgatgacaaaaacagctagtgacaaccacagtcatggattcatcactggtgaagtcatttgcgct |
47423698 |
T |
|
| Q |
115 |
ttgctttggggaaggtcgtggaagtcgaagacggcggacgagaatcgttgatcatgattcatcaccggtgaagtggattggccgtggaagttgaagaaat |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
47423697 |
ttgctttggggaaggtcgtggaagtcgaagacggcggacgagaatcgttgatcatgattcatcaccggtgaagtggagtggccgtgaaagttgaagaaat |
47423598 |
T |
|
| Q |
215 |
agtactagattgt |
227 |
Q |
| |
|
||||||||||||| |
|
|
| T |
47423597 |
agtactagattgt |
47423585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University