View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18188_low_15 (Length: 234)
Name: NF18188_low_15
Description: NF18188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18188_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 52 - 219
Target Start/End: Complemental strand, 11749845 - 11749679
Alignment:
| Q |
52 |
atcttcattttttacatggatggaatatttgtgagtaaacattgcaaaaa-agaggtcactgcttggttcggcgcatcgctggtacttacgccaaactta |
150 |
Q |
| |
|
|||||| || |||||||||| ||||||||| ||||||| ||||||||||| ||| |||||||||||||| ||||||| | ||| |||||||||| ||||| |
|
|
| T |
11749845 |
atcttcgttctttacatggacggaatatttttgagtaa-cattgcaaaaacagatgtcactgcttggtttggcgcattgatggcacttacgccagactta |
11749747 |
T |
|
| Q |
151 |
ttcactttactagagaaatgtagttttttcatctaccacaagaagttaaccaaggggttgatgttgatt |
219 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| |||||| ||||| ||||||||||||| |
|
|
| T |
11749746 |
ttcactttactggagaaatgtagttttttcatctaccacaag-agttaatcaaggagttgatgttgatt |
11749679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University