View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18188_low_18 (Length: 222)
Name: NF18188_low_18
Description: NF18188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18188_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 60 - 204
Target Start/End: Original strand, 46640711 - 46640855
Alignment:
| Q |
60 |
caacttactaccattatctctgatgagacaagagcttggaattttttattcttcttttcttccaaattggtatacgtaagagaattagaggtagtgttta |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46640711 |
caacttactaccattatctctgatgagacaagagcttggaattttttattcttcttttcttccaaattggtatacgtaagagaattagaggtagtgttta |
46640810 |
T |
 |
| Q |
160 |
attggtcatatatgtaaaaataaattataagaatttagctatttc |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46640811 |
attggtcatatatgtaaaaataaattataagaatttagctatttc |
46640855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 63 - 112
Target Start/End: Original strand, 46643477 - 46643526
Alignment:
| Q |
63 |
cttactaccattatctctgatgagacaagagcttggaattttttattctt |
112 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
46643477 |
cttaccaccattatctctgatgagataagagcttggaacattttattctt |
46643526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University