View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18188_low_19 (Length: 213)
Name: NF18188_low_19
Description: NF18188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18188_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 42559498 - 42559297
Alignment:
| Q |
1 |
agtgaaaaggtttatgggcttgggcttttgagttttgatccaaccatatataagaaacataagcagatttcgttgttaccgaatcttcataaccctagct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42559498 |
agtgaaaaggtttatgggcttgggcttttgagttttgacccaaccatatataataaacagaagcagatttcgttgttactgaatcttcataaccctagct |
42559399 |
T |
 |
| Q |
101 |
gccgcgaacgagcgaagaagacagcaaaaccttggagagcttcaacaacaatggtttgtgaattttatttgttaatctttctatttcctctgatctattc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42559398 |
gccgcgaacgagcgaagaagacagcaaaaccttggagagcttcaacaacaatggttagttaattttatttgttaatctttctatttcctctgatctattc |
42559299 |
T |
 |
| Q |
201 |
at |
202 |
Q |
| |
|
|| |
|
|
| T |
42559298 |
at |
42559297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University