View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18188_low_7 (Length: 278)

Name: NF18188_low_7
Description: NF18188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18188_low_7
NF18188_low_7
[»] chr4 (1 HSPs)
chr4 (17-264)||(2263556-2263805)
[»] chr1 (1 HSPs)
chr1 (148-193)||(21324828-21324873)


Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 17 - 264
Target Start/End: Original strand, 2263556 - 2263805
Alignment:
17 aaatatgcttttgaaaaactcaagtattgtctattgaagtaaataggattttcaaaaagcttaagttat-gtcttaaataggct-ggtgatacgcctttg 114  Q
    |||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| ||||||| | |||||    
2263556 aaatatacttttgaaaaactcaagtattgtctattgaagtaaataagattttcaaaaagcttaagttattgtcttaaataggctaggtgataggtctttg 2263655  T
115 tcggatgatttaacctgtttctatctctaataatgatgttgaattaatatgaactgtcacatcttcatttaacgtgtcatgtcatagtatttaacaattg 214  Q
    ||||| || |||| |||||||||||||||||| ||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| ||||    
2263656 tcggacgacttaatctgtttctatctctaatagtgatgttgaatcaatataaactgtcacatcttcatttaacgtgtcatgtcatagtatttaacgattg 2263755  T
215 aacttaatatactgttcaacgaacgaaattgctaattcgtaaaacatata 264  Q
    |||||||| || ||||||||||||||||||||||||||||||||||||||    
2263756 aacttaatgtaatgttcaacgaacgaaattgctaattcgtaaaacatata 2263805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 148 - 193
Target Start/End: Original strand, 21324828 - 21324873
Alignment:
148 tgatgttgaattaatatgaactgtcacatcttcatttaacgtgtca 193  Q
    |||||| ||||| | ||||||| |||||||||||||||||||||||    
21324828 tgatgtggaattcacatgaactatcacatcttcatttaacgtgtca 21324873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University