View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18190_low_11 (Length: 241)
Name: NF18190_low_11
Description: NF18190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18190_low_11 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 14 - 241
Target Start/End: Complemental strand, 30665926 - 30665701
Alignment:
| Q |
14 |
catcaagtccgcataagttccttgtgttcttaacacacaacctgcaaaattatgaattatgtaattattatacaagtaaagaagaagatagaggcattaa |
113 |
Q |
| |
|
||||||||| |||| |||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30665926 |
catcaagtctgcatcagttccttgtgttcttgacacacagcctgcaaaattatgaattatgtaattattatacaagtaaagaagaagatagaggcattaa |
30665827 |
T |
 |
| Q |
114 |
tgaatgtatatttgtaatgtgataacatacccttttttagtatttagaaggaaatgaaattcaaagtactatctctcaattgcttagttcaagttgttag |
213 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30665826 |
tgaat--atatttgtaatgtgataacatacccttttttagtatatagaaggaaatgaaattcaaagtactatctctcaattgcttagttcaagttgttaa |
30665729 |
T |
 |
| Q |
214 |
tcaaaatcagatcatacttgtaattggc |
241 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
30665728 |
tcaaaatcagatcatacttgtaattggc |
30665701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University