View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18190_low_12 (Length: 237)
Name: NF18190_low_12
Description: NF18190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18190_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 155 - 221
Target Start/End: Complemental strand, 19025266 - 19025199
Alignment:
| Q |
155 |
gggccgttcacttgagagtgtttaattcttagtgacacgggaaattgctggtacat-attgtattttg |
221 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
19025266 |
gggctgttcacttgagagtgtttaattcttagtgacacgggaaattgctggtacatgattgtattttg |
19025199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 4 - 47
Target Start/End: Complemental strand, 22621875 - 22621832
Alignment:
| Q |
4 |
aaattgcagcaccttgtatttgtgcctcatggaattagttagtt |
47 |
Q |
| |
|
|||| |||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
22621875 |
aaatagcagcagcttgtatttgtgcctcatggtattagttagtt |
22621832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University