View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18190_low_14 (Length: 220)
Name: NF18190_low_14
Description: NF18190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18190_low_14 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 48873874 - 48873649
Alignment:
| Q |
1 |
aacaacatctcagtaactacagtacaatgtatcacgcatatttgcagacaaaccatcaatat------tcacaaatttaagggcataatcactaataatt |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
48873874 |
aacaacatctcagtaactacagtacaatgtatcacgcatatttgcagacaaaccagcaatataaccattcacaaatttaagggcataatcactaataatt |
48873775 |
T |
 |
| Q |
95 |
acttcaaaacaagaatgctaaataggtttgccttttcaacatagagaatggtttaaagatttctctactaacttattttcgaggtttcttagcaattatc |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48873774 |
acttcaaaacaagaatgctaaataggtttgccttttcaacatagagaatggcttaaagatttctctactaacttattttcgaggtttcttagcaattatc |
48873675 |
T |
 |
| Q |
195 |
tcatgatatgaaggcaagtttggccc |
220 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
48873674 |
tcatgatatgaaggcaagtttggccc |
48873649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University