View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18191_high_10 (Length: 249)
Name: NF18191_high_10
Description: NF18191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18191_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 18 - 242
Target Start/End: Complemental strand, 35609111 - 35608887
Alignment:
| Q |
18 |
aatcgaacttaaactttaagtaagaacacactctcaaattccaagtcaatattaccggatcatcccaagtgggttcacttctcccaaaatttaataacac |
117 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35609111 |
aatcgaacttagactttaagtaagaacacactctcaaattccaagtcaatattaccggatcaacccaagtgggttcacttatcccaaaatttaataacac |
35609012 |
T |
|
| Q |
118 |
atcatagagatatatacataccagttaataatttttcatgctagctccttcgaatattgaggtcttaagtagcactagaagttgttgcagataccttagg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35609011 |
atcatagagatatatacataccagttaataatttttcatgctagctccttcgaatattgaggtcttaagtagcactagaagttgttgcagataccttagg |
35608912 |
T |
|
| Q |
218 |
tttaggcctcttccttttcttttca |
242 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
35608911 |
tttaggcctcttccttttcttttca |
35608887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University