View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18191_low_11 (Length: 254)
Name: NF18191_low_11
Description: NF18191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18191_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 5295042 - 5295283
Alignment:
| Q |
1 |
cggagtttgctaataaggttggagaagatgaagttgaaagtcctcatcctgttatgatgaagaagaaagctcgtgttttcgtggttcccaagattgaaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5295042 |
cggagtttgctaataaggttggagaagatgaagttgaaagtcctcatcctgttatgatgaagaagaaagctcgtgttttcgtggtgcccaagattgaaat |
5295141 |
T |
|
| Q |
101 |
tccgaattttcagtgatgaattatttgagatgtagatttacttttagtgaaagattagtagacaagtttattttatttcttatttggaaaattttgagga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5295142 |
tccgaattttcagtgatgaattatttgagatgtagatttacttttagtgaaagattagtagacaagtttattttatttcttatttggaaaatttttagga |
5295241 |
T |
|
| Q |
201 |
ttatatgattttgtataaaatttgggtttggggattcatttc |
242 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
5295242 |
ttatatgattttgtataaagtttgggttgggggattcatttc |
5295283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University