View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18192_low_11 (Length: 342)
Name: NF18192_low_11
Description: NF18192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18192_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 305; Significance: 1e-172; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 305; E-Value: 1e-172
Query Start/End: Original strand, 1 - 325
Target Start/End: Original strand, 33519378 - 33519702
Alignment:
| Q |
1 |
taaaagaaaatggctatatcgttctttcttagtaactttttccgctcttctgatggcaaggttactagatcccctagtttttggcgagtaccctgctgat |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33519378 |
taaaagaaaatggctctatcgttctttcttagtaactttttccgctcttctgatggcaaggttactagatcccctagtttttggcgagtaccctgctgat |
33519477 |
T |
|
| Q |
101 |
atgcgctctattcttgggagccagttgcctaggttctcatctaaggagaagagcctcctaagaggcagcctggacttcattggcatcaataactacgggg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33519478 |
atgcgctctattcttgggagccagttgcctaggttctcatctaaggagaagagcctcctaagaggcagcctggacttcattggcatcaataactacgggg |
33519577 |
T |
|
| Q |
201 |
ctctctatgccaaggaatgctacctctcaacttgccctctcgaagcagctcgtccaataaaaggctttttgcaaacaacaggaatgagagatggcattcc |
300 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
33519578 |
ctctctatgccaaggattgctacctctctacttgccctctcgaagcagctcgtccaataaaaggctttttgcaaacaactgggatgagagatggcattcc |
33519677 |
T |
|
| Q |
301 |
aattggtgatcaggtactcatatgt |
325 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
33519678 |
aattggtgatcaggtactcatatgt |
33519702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 58 - 325
Target Start/End: Complemental strand, 33496521 - 33496254
Alignment:
| Q |
58 |
aaggttactagatcccctagtttttggcgagtaccctgctgatatgcgctctattcttgggagccagttgcctaggttctcatctaaggagaagagcctc |
157 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| || |||||| | | |||| | ||||||||||| ||| |
|
|
| T |
33496521 |
aaggttactagatcccctagtttttggtgagtaccctgctgagatgcgctctattcttgggaaccggttgccaaagatctctacgaaggagaagagtctc |
33496422 |
T |
|
| Q |
158 |
ctaagaggcagcctggacttcattggcatcaataactacggggctctctatgccaaggaatgctacctctcaacttgccctctcgaagcagctcgtccaa |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| ||||||||||| ||||| || ||||| ||||||||||||| |
|
|
| T |
33496421 |
ctaagaggcagcctggacttcattggcatcaataactatggagctctctatgccaaggattgctacctctctacttgtccactcgaggcagctcgtccaa |
33496322 |
T |
|
| Q |
258 |
taaaaggctttttgcaaacaacaggaatgagagatggcattccaattggtgatcaggtactcatatgt |
325 |
Q |
| |
|
||| ||||||| || ||||||| || |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33496321 |
taagaggctttctggaaacaactgggatgagagatggcattccaattggtgatcaggtactcgtatgt |
33496254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University