View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18192_low_14 (Length: 302)
Name: NF18192_low_14
Description: NF18192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18192_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 11 - 288
Target Start/End: Original strand, 38466100 - 38466377
Alignment:
| Q |
11 |
cataggcccataccctaactaacgtaggataagatttcactggctaaacttgcgttacaatttacaaacaccatggcagtagcagcaagttctaccttct |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38466100 |
cataggcccataccctaactaacgtaggataagatttcactggctaaacttgcgttacaatttacaaacaccatggcagtagcagcaagttctaccttct |
38466199 |
T |
 |
| Q |
111 |
catcctcactatcaacggtatgtaccttacaaaaccgccatgcatcacaacccacaacctttttaggcattcccctatgtcagaaaacgttcctcagtaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38466200 |
catcctcactatcaacggtatgtaccttacaaaaccgccatgcatcacaacccacaacctttttaggcattcccctatgtcagaaaacgttcctcagtaa |
38466299 |
T |
 |
| Q |
211 |
caaaaaatcaccacacaagtttttaacagtggcagtgaccaaaggctcagcagagtcaagtaaatccgatgaaaaaat |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38466300 |
caaaaaatcaccacacaagtttttaacagtggcagtgaccaaaggctcagcagagtcaagtaaatccgatgaaaaaat |
38466377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University