View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18192_low_16 (Length: 285)
Name: NF18192_low_16
Description: NF18192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18192_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 12 - 271
Target Start/End: Original strand, 23007613 - 23007872
Alignment:
| Q |
12 |
aaaggaagtgaatctaaatcagatgtagctagcaagaaaataaagaagtcaaccacctcaaagaccaaaaagagttcaagggtaattattttatagtttt |
111 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23007613 |
aaaggaagtgagtctaaatcagatgtagctagcaagaaaataaagaagtcaaccacctcaaagaccaaaaagagttcaagggtaattattttatagtttt |
23007712 |
T |
|
| Q |
112 |
gacaaaatacgtcttttatgtttcactatcctagtttttgaacttttcttcatgctcaaatcatccagtccaaaggtgcaaaaggtctagaagaaaagaa |
211 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23007713 |
gacaaaatacttcttttatgtttcactatcctagtttttgaacttttcttcatgctcaaatcatccagtccaaaggtgcaaaaggtctagaagaaaagaa |
23007812 |
T |
|
| Q |
212 |
attgaatctgtcgaaagtctagtgggaatgtcggttcaccaaaccgataaaggcaaagtt |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23007813 |
attgaatctgtcgaaagtctagtgggaatgtcggttcaccaaaccgataaaggcaaagtt |
23007872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University