View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18192_low_19 (Length: 246)
Name: NF18192_low_19
Description: NF18192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18192_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 38620270 - 38620499
Alignment:
| Q |
1 |
gtttgtccataaccacaaatgccacacaataaagcaaatcaaatgcccactcattttctgcaaatgttgagaatat--cataagaatggttataatgcag |
98 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38620270 |
gtttatccataaccacaaatgccacacaataaagcaaatcaaatgcccactcattttctgcaaatgttgagaatatatcataagaatggttataatgcag |
38620369 |
T |
|
| Q |
99 |
aggacgaaattgtgatcaatttaggttttccttctcaaaacaaaataaaacaatagtttctaattcttacctgacagcatttgtagaaaaactgttctta |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38620370 |
aggacgaaattgtgatcaatttaggttttccttctcaaaacaaaataaaacaatagtttctaattcttacctgacagcatttgtagaaaaactgttctta |
38620469 |
T |
|
| Q |
199 |
tgaaagtcctgggtttggctgcaagtgaag |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
38620470 |
tgaaagtcctgggtttggctgcaagtgaag |
38620499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University