View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18192_low_22 (Length: 206)
Name: NF18192_low_22
Description: NF18192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18192_low_22 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 76; Significance: 2e-35; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 105 - 196
Target Start/End: Original strand, 34361320 - 34361411
Alignment:
| Q |
105 |
gtttattatgttcacacgtatccgagacccagacacatgcatccaatggtttttaatacaaaacttactccataaaactactcatgcttgct |
196 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
34361320 |
gtttattatgttcacacctatccgacacccagacacatgcatccaatggtttttaatacaaaacttactccataaaactactaatgcatgct |
34361411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 34361213 - 34361273
Alignment:
| Q |
1 |
catgtttaccatcaggtgcctgtgttactccttacaccttcacaactgccattgatccaga |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
34361213 |
catgtttaccatcaggtgcctgtgttactccttataccttcacaactgccattgatccaga |
34361273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 5 - 65
Target Start/End: Complemental strand, 12118416 - 12118356
Alignment:
| Q |
5 |
tttaccatcaggtgcctgtgttactccttacaccttcacaactgccattgatccagagaag |
65 |
Q |
| |
|
|||||||||| ||||||||||| ||||||| ||| |||||||||||||||||| ||||||| |
|
|
| T |
12118416 |
tttaccatcacgtgcctgtgttcctccttataccatcacaactgccattgatctagagaag |
12118356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 5 - 65
Target Start/End: Original strand, 37166992 - 37167052
Alignment:
| Q |
5 |
tttaccatcaggtgcctgtgttactccttacaccttcacaactgccattgatccagagaag |
65 |
Q |
| |
|
|||||||||| ||||||||||| ||||||| ||| |||||||||||||||||| ||||||| |
|
|
| T |
37166992 |
tttaccatcacgtgcctgtgttcctccttataccatcacaactgccattgatctagagaag |
37167052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University