View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18192_low_23 (Length: 205)
Name: NF18192_low_23
Description: NF18192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18192_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-100; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 43475417 - 43475230
Alignment:
| Q |
1 |
attcaccgcctcaagggagtacgaattcagctgtagcaacactcccaaccacttcttcccaattgggaagcgtcaccgtagccacaacaacttctccact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43475417 |
attcaccgcctcaagggagtacgaattcagctgtagcaacactcccaaccacttcttcccaattgggaagcgtcaccgtagccacaacaacttctccact |
43475318 |
T |
 |
| Q |
101 |
tccgctcaagcgccacctacacaagatgatgatgtggcaacaatgagcgcaatgaaggcagtgctggagatgcttagcaatgatcagt |
188 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43475317 |
tccgctcaagcaccacctacacaagatgatgatgtggcaacaatgagcgcaatgaaggcagtgctggagatgcttagcaatgatcagt |
43475230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 5 - 186
Target Start/End: Complemental strand, 43486029 - 43485836
Alignment:
| Q |
5 |
accgcctcaagggagtacgaattcagctgtagcaacactcccaaccacttcttcccaattgggaagcgtcaccgtagc------------cacaacaact |
92 |
Q |
| |
|
||||| ||||||||||| ||||||||||| || |||||||| | ||||| |||||||| ||||| |||||||| ||| |||||||| | |
|
|
| T |
43486029 |
accgcatcaagggagtatgaattcagctgcagtaacactcctcatcactttttcccaatagggaaacgtcaccgcagcaacaaccacaatcacaacaatt |
43485930 |
T |
 |
| Q |
93 |
tctccacttccgctcaagcgccacctacacaagatgatgatgtggcaacaatgagcgcaatgaaggcagtgctggagatgcttagcaatgatca |
186 |
Q |
| |
|
||| ||||| |||||| |||||||||| || || ||||||||||| || ||||||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
43485929 |
tcttcacttgcgctcatacgccacctacgcaggacgatgatgtggcgactatgagcgcaatgaaggccgtgctggagatgcttaacaatgatca |
43485836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University