View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18193_low_1 (Length: 310)

Name: NF18193_low_1
Description: NF18193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18193_low_1
NF18193_low_1
[»] chr3 (1 HSPs)
chr3 (125-298)||(39042786-39042957)


Alignment Details
Target: chr3 (Bit Score: 155; Significance: 3e-82; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 125 - 298
Target Start/End: Original strand, 39042786 - 39042957
Alignment:
125 aggcatagtggacttgttttagcaaggaacatgcaaaataaattgaattaatcatcttccgcttgtctaaaaaagatttaaatgccaaagaaatatatac 224  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
39042786 aggcatagtggacttgttttagcaaggaacatgcaaaataaattgaattaatcatcttccgcttgtctaaaagagatttaaatgccaaagaaatatatac 39042885  T
225 acaagaacacgaatataatataaaatttaaaatctttttggtaaatactcatttcaaagtactttggttagtat 298  Q
    |||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39042886 acaagaacacg--gataatataaaatttaaaatctttttggtaaatactcatttcaaagtactttggttagtat 39042957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University