View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18193_low_1 (Length: 310)
Name: NF18193_low_1
Description: NF18193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18193_low_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 3e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 125 - 298
Target Start/End: Original strand, 39042786 - 39042957
Alignment:
| Q |
125 |
aggcatagtggacttgttttagcaaggaacatgcaaaataaattgaattaatcatcttccgcttgtctaaaaaagatttaaatgccaaagaaatatatac |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
39042786 |
aggcatagtggacttgttttagcaaggaacatgcaaaataaattgaattaatcatcttccgcttgtctaaaagagatttaaatgccaaagaaatatatac |
39042885 |
T |
|
| Q |
225 |
acaagaacacgaatataatataaaatttaaaatctttttggtaaatactcatttcaaagtactttggttagtat |
298 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39042886 |
acaagaacacg--gataatataaaatttaaaatctttttggtaaatactcatttcaaagtactttggttagtat |
39042957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University