View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18194_low_10 (Length: 329)
Name: NF18194_low_10
Description: NF18194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18194_low_10 |
 |  |
|
| [»] scaffold0067 (1 HSPs) |
 |  |  |
|
| [»] scaffold0951 (1 HSPs) |
 |  |  |
|
| [»] scaffold0922 (1 HSPs) |
 |  |  |
|
| [»] scaffold0606 (1 HSPs) |
 |  |  |
|
| [»] scaffold0474 (2 HSPs) |
 |  |  |
|
| [»] scaffold0283 (2 HSPs) |
 |  |  |
|
| [»] scaffold0122 (2 HSPs) |
 |  |  |
|
| [»] scaffold0102 (1 HSPs) |
 |  |  |
|
| [»] scaffold0035 (2 HSPs) |
 |  |  |
|
| [»] scaffold0022 (2 HSPs) |
 |  |  |
|
| [»] scaffold0014 (3 HSPs) |
 |  |  |
|
| [»] scaffold0001 (2 HSPs) |
 |  |  |
|
| [»] scaffold1067 (2 HSPs) |
 |  |  |
|
| [»] scaffold0864 (2 HSPs) |
 |  |  |
|
| [»] scaffold0777 (1 HSPs) |
 |  |  |
|
| [»] scaffold0693 (1 HSPs) |
 |  |  |
|
| [»] scaffold0594 (2 HSPs) |
 |  |  |
|
| [»] scaffold0370 (4 HSPs) |
 |  |  |
|
| [»] scaffold0352 (2 HSPs) |
 |  |  |
|
| [»] scaffold0328 (2 HSPs) |
 |  |  |
|
| [»] scaffold0227 (2 HSPs) |
 |  |  |
|
| [»] scaffold0182 (3 HSPs) |
 |  |  |
|
| [»] scaffold0078 (2 HSPs) |
 |  |  |
|
| [»] scaffold0005 (3 HSPs) |
 |  |  |
|
| [»] scaffold0121 (2 HSPs) |
 |  |  |
|
| [»] scaffold0016 (3 HSPs) |
 |  |  |
|
| [»] scaffold0031 (1 HSPs) |
 |  |  |
|
| [»] scaffold0272 (4 HSPs) |
 |  |  |
|
| [»] scaffold0154 (1 HSPs) |
 |  |  |
|
| [»] scaffold0213 (2 HSPs) |
 |  |  |
|
| [»] scaffold0032 (1 HSPs) |
 |  |  |
|
| [»] scaffold1171 (1 HSPs) |
 |  |  |
|
| [»] scaffold0854 (1 HSPs) |
 |  |  |
|
| [»] scaffold0047 (1 HSPs) |
 |  |  |
|
| [»] scaffold0028 (2 HSPs) |
 |  |  |
|
| [»] scaffold0019 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 236; Significance: 1e-130; HSPs: 178)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 18 - 265
Target Start/End: Complemental strand, 14552462 - 14552215
Alignment:
| Q |
18 |
agcttacccttctttttcttctttgaaaactccaatttcaaagtaccaatgtgacttccaaatttgcgtaaaagcctatctttgagctcacgatcttctc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14552462 |
agcttacccttctttttcttctttgaaaactccaatttcaaagtaccaatgtgacttccaaatttgcgtaaaagcctatctttgagctcacgatcttctc |
14552363 |
T |
 |
| Q |
118 |
cccttgattgtccatcttgaacatcaccatctcctgtactaagatcttcgtccgaagatgcaccaccatcatctagcaaaacaaagacaataggaaaatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14552362 |
cccttgattgtccatcttgaacatcaccatctcctgtactaagatcttcgtccgaagatgcaccaccatcatctagcaaaacaaagacaataggaaaatt |
14552263 |
T |
 |
| Q |
218 |
cattaagctcaaggttatttgtttctatctctatgttaatgttaaaaa |
265 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||||| |||||||||| |
|
|
| T |
14552262 |
cattaagctcaatgttatttgtttctatctcaatgttgatgttaaaaa |
14552215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 1055409 - 1055457
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1055409 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
1055457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 4096726 - 4096678
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4096726 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
4096678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 29391289 - 29391241
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29391289 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
29391241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 274 - 323
Target Start/End: Complemental strand, 13765538 - 13765489
Alignment:
| Q |
274 |
aattgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
13765538 |
aattgcggttatggacccctaactaatttaaatacaaaacagccccctat |
13765489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 263 - 324
Target Start/End: Original strand, 41880067 - 41880128
Alignment:
| Q |
263 |
aaaataggcttaattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||| || |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41880067 |
aaaataggcttaattgcacttttggacccctaactaatttaaatacaaaacagccccctatg |
41880128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 3020869 - 3020821
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3020869 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
3020821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 4125482 - 4125530
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4125482 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
4125530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 7219772 - 7219724
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7219772 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
7219724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 8339997 - 8340045
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8339997 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
8340045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 8755051 - 8755099
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8755051 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
8755099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 10029347 - 10029299
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10029347 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
10029299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 13170155 - 13170107
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
13170155 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
13170107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 13356824 - 13356776
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
13356824 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
13356776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 13960965 - 13960917
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13960965 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccttatg |
13960917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 14647734 - 14647782
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
14647734 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
14647782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 16521192 - 16521240
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
16521192 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
16521240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 20974498 - 20974546
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
20974498 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
20974546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 21583361 - 21583409
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
21583361 |
ttgcggttatggaccactaactaatttaaatacaaaacagccccctatg |
21583409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 26151832 - 26151880
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26151832 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
26151880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 27264147 - 27264195
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
27264147 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
27264195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 28394971 - 28395019
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28394971 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
28395019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 31455920 - 31455968
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
31455920 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
31455968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 34169063 - 34169015
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
34169063 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
34169015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 34734348 - 34734300
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
34734348 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
34734300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 35678358 - 35678310
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35678358 |
ttgcggttatggacctctaactaatttaaatacaaaacagtcccctatg |
35678310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 39528804 - 39528852
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
39528804 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
39528852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 40687704 - 40687752
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40687704 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
40687752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 40767926 - 40767974
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40767926 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
40767974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 40768163 - 40768115
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40768163 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
40768115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 42779205 - 42779253
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42779205 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
42779253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 276 - 323
Target Start/End: Original strand, 3020632 - 3020679
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3020632 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctat |
3020679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 324
Target Start/End: Original strand, 22773626 - 22773669
Alignment:
| Q |
281 |
gttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22773626 |
gttatggacctctaactaatttaaatacaaaacagccccctatg |
22773669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 276 - 323
Target Start/End: Complemental strand, 23263420 - 23263373
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
23263420 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctat |
23263373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 278 - 324
Target Start/End: Complemental strand, 14647961 - 14647915
Alignment:
| Q |
278 |
gcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
14647961 |
gcggttatggacccctaactaatttaaatacaaaacagccccctatg |
14647915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 279 - 324
Target Start/End: Original strand, 8986651 - 8986696
Alignment:
| Q |
279 |
cggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8986651 |
cggttatggacccctaactaatttaaatacaaaacagccccctatg |
8986696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 223169 - 223121
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
223169 |
ttgcggttatggacccctaaataatttaaatacaaaacagccccctatg |
223121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 931885 - 931933
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
931885 |
ttgcggttatggacccataactaatttaaatacaaaacagccccctatg |
931933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 1050074 - 1050122
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
1050074 |
ttgcggttatggacccttaactaatttaaatacaaaacagccccctatg |
1050122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 2710378 - 2710426
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
2710378 |
ttgcggttatggacccctaactaatttaaatacaaagcagccccctatg |
2710426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 2710612 - 2710564
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
2710612 |
ttgcggttatggacccctaactaatttaaatacaaaacagctccctatg |
2710564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 3738511 - 3738463
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
3738511 |
ttgcggttatggacccctaactaatttaaatacaaaacagtcccctatg |
3738463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 4096490 - 4096538
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4096490 |
ttgcgtttatggacccctaactaatttaaatacaaaacagccccctatg |
4096538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 5088347 - 5088299
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
5088347 |
ttgcggttatggacccctaactaatttaaatacaaaacagtcccctatg |
5088299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 7623559 - 7623607
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
7623559 |
ttgcggttatggacccctaactaatttaaatacaaaacagtcccctatg |
7623607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 8755284 - 8755240
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8755284 |
ggttatggacccctaactaatttaaatacaaaacagccccctatg |
8755240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 12049161 - 12049205
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12049161 |
ggttatggacccctaactaatttaaatacaaaacagccccctatg |
12049205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 12049392 - 12049344
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12049392 |
ttgcggttatagacccctaactaatttaaatacaaaacagccccctatg |
12049344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 13356595 - 13356643
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
13356595 |
ttgcggttatggacccctaactaatttaaatacaaaacacccccctatg |
13356643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 13765297 - 13765345
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
13765297 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccctatg |
13765345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 13960726 - 13960774
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
13960726 |
ttgcggttatggacccctaactaatttaaatacaaaacagccctctatg |
13960774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 15526944 - 15526896
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
15526944 |
ttgcggttatggacccttaactaatttaaatacaaaacagccccctatg |
15526896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 15738112 - 15738160
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
15738112 |
ttgcggttatggatccctaactaatttaaatacaaaacagccccctatg |
15738160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 16329619 - 16329667
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
16329619 |
ttgcggttatggacccctaactaatttaaatacaaaacagccctctatg |
16329667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 16597079 - 16597127
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
16597079 |
ttgcggttatggacccctaactaatttaaatacaaaacagcctcctatg |
16597127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 320
Target Start/End: Original strand, 18266390 - 18266434
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccc |
320 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
18266390 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccc |
18266434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 19849590 - 19849638
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
19849590 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccctatg |
19849638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 19849818 - 19849770
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
19849818 |
ttgcggtcatggacccctaactaatttaaatacaaaacagccccctatg |
19849770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 20974680 - 20974636
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
20974680 |
ggttatggacccctaactaatttaaatacaaaacagccccctatg |
20974636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 22052714 - 22052666
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
22052714 |
ttgcggttatggacccctaactaatttaaatacaaaatagccccctatg |
22052666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 22627258 - 22627210
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
22627258 |
ttgcggttctggacccctaactaatttaaatacaaaacagccccctatg |
22627210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 22773860 - 22773812
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
22773860 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccatatg |
22773812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 23104182 - 23104134
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
23104182 |
ttgcggttatggacccctaactaatttaaatacaaaatagccccctatg |
23104134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 23500004 - 23500052
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
23500004 |
ttgcggttatgaacctctaactaatttaaatacaaaacagcccgctatg |
23500052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 26036491 - 26036443
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
26036491 |
ttgcggttatggccccctaactaatttaaatacaaaacagccccctatg |
26036443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 26323650 - 26323602
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
26323650 |
ttgcggttatggacccctaactaatttaaatacaaaacagtcccctatg |
26323602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 27264380 - 27264332
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
27264380 |
ttgcggttatggacccctaactaatttaaatacaaaacagtcccctatg |
27264332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 28620081 - 28620125
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28620081 |
ggttatggacccctaactaatttaaatacaaaacagccccctatg |
28620125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 28736478 - 28736526
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
28736478 |
ttgcggttatggacccctaactaatttaaatacaaaatagccccctatg |
28736526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 28736715 - 28736667
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
28736715 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccctatg |
28736667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 29183171 - 29183219
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
29183171 |
ttgcggttatggacccctaactaacttaaatacaaaacagccccctatg |
29183219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 29183410 - 29183362
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29183410 |
ttgcggttatggacacctaactaatttaaatacaaaacagccccctatg |
29183362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 29401364 - 29401316
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
29401364 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccctatg |
29401316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 29559812 - 29559860
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29559812 |
ttgcggttatggactcctaactaatttaaatacaaaacagccccctatg |
29559860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 30894163 - 30894211
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
30894163 |
ttgcggttatggacccataactaatttaaatacaaaacagccccctatg |
30894211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 30894387 - 30894343
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30894387 |
ggttatggacccctaactaatttaaatacaaaacagccccctatg |
30894343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 31172602 - 31172650
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
31172602 |
ttgcgattatggacccctaactaatttaaatacaaaacagccccctatg |
31172650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 31172839 - 31172791
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
31172839 |
ttgcggttatggacccctaactaatttaaatacaaaacagtcccctatg |
31172791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 31456136 - 31456088
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
31456136 |
ttgcggttatgaacccctaactaatttaaatacaaaacagccccctatg |
31456088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 34082137 - 34082185
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
34082137 |
ttgcggttatggacccctaactaatttaaatacaaaacagccctctatg |
34082185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 34606645 - 34606597
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
34606645 |
ttgcggttatggacccctagctaatttaaatacaaaacagccccctatg |
34606597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 35055815 - 35055863
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
35055815 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccctatg |
35055863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 35678130 - 35678178
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35678130 |
ttgcgattatggacccctaactaatttaaatacaaaacagccccctatg |
35678178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 40297703 - 40297751
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
40297703 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccctatg |
40297751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 40297941 - 40297893
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
40297941 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccctatg |
40297893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 40687944 - 40687896
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40687944 |
ttgcagttatggacccctaactaatttaaatacaaaacagccccctatg |
40687896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 41880312 - 41880264
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
41880312 |
ttgcggttatggacccctaactaatttaaatacaaaacagtcccctatg |
41880264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 42739569 - 42739613
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42739569 |
ggttatggacccctaactaatttaaatacaaaacagccccctatg |
42739613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 43585843 - 43585891
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
43585843 |
ttgcggttatggccccctaactaatttaaatacaaaacagccccctatg |
43585891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 276 - 323
Target Start/End: Original strand, 3728322 - 3728369
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
3728322 |
ttgcggttatggtcccctaactaatttaaatacaaaacagccccctat |
3728369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 276 - 319
Target Start/End: Complemental strand, 4125719 - 4125676
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccc |
319 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4125719 |
ttgcggttatggacccctaactaatttaaatacaaaacagcccc |
4125676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 280 - 323
Target Start/End: Complemental strand, 8986881 - 8986838
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8986881 |
ggttatggacccctaactaatttaaatacaaaacagccccctat |
8986838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 274 - 324
Target Start/End: Original strand, 34734110 - 34734161
Alignment:
| Q |
274 |
aattgcggttatgga-cctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
34734110 |
aattgcggttatggatcccctaactaatttaaatacaaaacagccccctatg |
34734161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 276 - 314
Target Start/End: Original strand, 3738426 - 3738464
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaaca |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3738426 |
ttgcggttatggacctctaactaatttaaatacaaaaca |
3738464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 276 - 322
Target Start/End: Original strand, 22052477 - 22052523
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccccta |
322 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
22052477 |
ttgcggttatggacccctaactaatttaaatacaaaacaacccccta |
22052523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 274 - 324
Target Start/End: Complemental strand, 28388257 - 28388207
Alignment:
| Q |
274 |
aattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
28388257 |
aattgaggttatggacccctaactaatttaaatacaaaacaaccccctatg |
28388207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 276 - 322
Target Start/End: Original strand, 34168825 - 34168871
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccccta |
322 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34168825 |
ttgcggttatggacccataactaatttaaatacaaaacagcccccta |
34168871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 279 - 324
Target Start/End: Original strand, 2546412 - 2546457
Alignment:
| Q |
279 |
cggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2546412 |
cggttatgaacccctaactaatttaaatacaaaacagccccctatg |
2546457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 267 - 324
Target Start/End: Complemental strand, 16521440 - 16521383
Alignment:
| Q |
267 |
taggcttaattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| |||||||| || |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
16521440 |
taggtttaattgcacttttggacccctaactaatttaaatacaaaacagccccctatg |
16521383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 39027 - 39075
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||| |||||||| |
|
|
| T |
39027 |
ttgcggttatggtcccctaactaatttaaatacaaaacagtcccctatg |
39075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 3223559 - 3223511
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||| |||||||| |
|
|
| T |
3223559 |
ttgcggttatggccccctaactaatttaaatacaaaacagacccctatg |
3223511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 5891539 - 5891586
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5891539 |
ttgcggttatg-acccctaactaatttaaatacaaaacagccccctatg |
5891586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 7219536 - 7219584
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
7219536 |
ttgcggttatggacccttaattaatttaaatacaaaacagccccctatg |
7219584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 7623795 - 7623747
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||| ||||||||||| |
|
|
| T |
7623795 |
ttgcggttatggacccctaaccaatttaaatacaaaatagccccctatg |
7623747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 9072006 - 9072054
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
9072006 |
ttgcggttatgtccccctaactaatttaaatacaaaacagccccctatg |
9072054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 11480078 - 11480122
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
11480078 |
ggttatggacccctaactaatttaaatacaaaatagccccctatg |
11480122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 15526742 - 15526790
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| || ||||||||| |
|
|
| T |
15526742 |
ttgcggttatggacccctaactaatttaaatacaaagcaaccccctatg |
15526790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 15738348 - 15738300
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||| ||||||||| |
|
|
| T |
15738348 |
ttgcggttatggacccctaattaatttaaatacaaaacaaccccctatg |
15738300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 16079453 - 16079405
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||| |||||||| |
|
|
| T |
16079453 |
ttgcggttatggccccctaactaatttaaatacaaaacagtcccctatg |
16079405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 16329850 - 16329806
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
16329850 |
ggttatggacccctaactaatttaaatacaaaacaaccccctatg |
16329806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 21583598 - 21583550
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
21583598 |
ttgcggttatggactcctaactaatttaaatacaaaacagtcccctatg |
21583550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 22925908 - 22925864
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
22925908 |
ggttatggacttctaactaatttaaatacaaaacaaccccctatg |
22925864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 23103961 - 23104009
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||| ||||||||| |
|
|
| T |
23103961 |
ttgcggttatggacccctaattaatttaaatacaaaacaaccccctatg |
23104009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 25631356 - 25631308
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||||| |||| |
|
|
| T |
25631356 |
ttgcggttatggacccctaattaatttaaatacaaaacagccccatatg |
25631308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 26152067 - 26152019
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| | ||||||| |
|
|
| T |
26152067 |
ttgcggttatggacccctaactaatttaaatacaaaacaactccctatg |
26152019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 26323417 - 26323461
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
26323417 |
ggttatggacccctaactaatttaaatacaaaacagccccttatg |
26323461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 28251436 - 28251484
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||| |||| |
|
|
| T |
28251436 |
ttgcggttatggccccctaactaatttaaatacaaaacagccccttatg |
28251484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 32555802 - 32555850
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||| |||| |
|
|
| T |
32555802 |
ttgcggttatggccccctaactaatttaaatacaaaacagccccttatg |
32555850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 33203976 - 33204024
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
33203976 |
ttgcggttatagacctctaattaatttaaatacaaaacagccccttatg |
33204024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 35306977 - 35306929
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||| |||| |
|
|
| T |
35306977 |
ttgcggttatggacccctaactaatttaaatgcaaaacagccccttatg |
35306929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 39529040 - 39528992
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
39529040 |
ttgcggttatggattcctaactaatttaaatacaaaacagccccctatg |
39528992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 42739862 - 42739814
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
42739862 |
ttgcggttatgaacccctaactaatttaaatacaaaacaaccccctatg |
42739814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 42947439 - 42947487
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| || ||||| |
|
|
| T |
42947439 |
ttgcggttatggacctctaactaatttaaatataaaacagtcctctatg |
42947487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 43586061 - 43586013
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||| ||||||||| |
|
|
| T |
43586061 |
ttgcggttatggccccctaactaatttaaatacaaaacaaccccctatg |
43586013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 269 - 324
Target Start/End: Complemental strand, 932130 - 932075
Alignment:
| Q |
269 |
ggcttaattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| || |||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
932130 |
ggcttaattgcacttttggacccctaactaatttaaatacaaaacagtcccctatg |
932075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 276 - 319
Target Start/End: Original strand, 10029112 - 10029155
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccc |
319 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
10029112 |
ttgcggttatggaccactaactaatttaaatacaaaatagcccc |
10029155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 276 - 319
Target Start/End: Original strand, 16666111 - 16666154
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccc |
319 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
16666111 |
ttgcggttatggacccctaactaatttaaatataaaacagcccc |
16666154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 281 - 324
Target Start/End: Original strand, 22627028 - 22627071
Alignment:
| Q |
281 |
gttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
22627028 |
gttaaggacccctaactaatttaaatacaaaacagccccctatg |
22627071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 269 - 324
Target Start/End: Original strand, 25566645 - 25566700
Alignment:
| Q |
269 |
ggcttaattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| || |||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
25566645 |
ggcttaattgcacttttggacccctaactaatttaaatacaaaacagccctctatg |
25566700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 281 - 324
Target Start/End: Original strand, 29391056 - 29391099
Alignment:
| Q |
281 |
gttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29391056 |
gttatagacccctaactaatttaaatacaaaacagccccctatg |
29391099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 285 - 324
Target Start/End: Original strand, 34606418 - 34606457
Alignment:
| Q |
285 |
tggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
34606418 |
tggacccctaactaatttaaatacaaaacagccccctatg |
34606457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 285 - 324
Target Start/End: Original strand, 42739634 - 42739673
Alignment:
| Q |
285 |
tggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42739634 |
tggacccctaactaatttaaatacaaaacagccccctatg |
42739673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 282 - 324
Target Start/End: Complemental strand, 23502397 - 23502355
Alignment:
| Q |
282 |
ttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
23502397 |
ttatggacccctaactaattaaaatacaaaacagccccctatg |
23502355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 276 - 318
Target Start/End: Original strand, 35306748 - 35306790
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccc |
318 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
35306748 |
ttgcggttatgaacccctaactaatttaaatacaaaacagccc |
35306790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 276 - 317
Target Start/End: Original strand, 9559892 - 9559933
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcc |
317 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
9559892 |
ttgcggttatggccctctaactaatataaatacaaaacagcc |
9559933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 283 - 324
Target Start/End: Original strand, 28388026 - 28388067
Alignment:
| Q |
283 |
tatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
28388026 |
tatggacccctaactaatttaaatacaaaacagcaccctatg |
28388067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 279 - 324
Target Start/End: Complemental strand, 33204211 - 33204166
Alignment:
| Q |
279 |
cggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| ||| |||| |
|
|
| T |
33204211 |
cggttatggacccctaactaatttaaatacaaaacagtcccttatg |
33204166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 1055643 - 1055595
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||| | |||||| |
|
|
| T |
1055643 |
ttgcggttatagacccctaactaatttaaatacaaaacagtctcctatg |
1055595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 2546647 - 2546599
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| |||||||| | |||||||||||||||||||||||||||| |||| |
|
|
| T |
2546647 |
ttgcagttatggatccctaactaatttaaatacaaaacagccccttatg |
2546599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 274 - 314
Target Start/End: Original strand, 3223472 - 3223512
Alignment:
| Q |
274 |
aattgcggttatggacctctaactaatttaaatacaaaaca |
314 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
3223472 |
aattgcggttatggccccctaactaatttaaatacaaaaca |
3223512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 4146145 - 4146193
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| || |||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
4146145 |
ttgcgattttggacccctaactaattaaaatacaaaacagccccctatg |
4146193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 5088112 - 5088160
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||| |||| |||| |
|
|
| T |
5088112 |
ttgcagttatggacccctaactaatttaaatacaaaacaaccccttatg |
5088160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 5891755 - 5891708
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||| ||||||||| |
|
|
| T |
5891755 |
ttgcggttatggccc-ctaactaatttaaatacaaaacaaccccctatg |
5891708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 8340235 - 8340187
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| ||||||||| | ||||||||||||||||||||| ||||||||| |
|
|
| T |
8340235 |
ttgcgcttatggaccccaaactaatttaaatacaaaacaaccccctatg |
8340187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 9560109 - 9560061
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||||||| |||| |
|
|
| T |
9560109 |
ttgcggttatgaccccctaactaatttaaatacaaaacagccccatatg |
9560061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #146
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 16597315 - 16597267
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
16597315 |
ttgcggttatggactcataactaatttaaatacaaaacaaccccctatg |
16597267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #147
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 320
Target Start/End: Complemental strand, 16666848 - 16666804
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccc |
320 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
16666848 |
ttgcggttatggactcctaactaatttaaatacaaaacaaccccc |
16666804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #148
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 16860000 - 16860044
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||| |||||||| |
|
|
| T |
16860000 |
ggttatggccccctaactaatttaaatacaaaacagacccctatg |
16860044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #149
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 20465541 - 20465589
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| ||||||| || ||||||||||||||||||||||| ||||||||| |
|
|
| T |
20465541 |
ttgcagttatggccccctaactaatttaaatacaaaacaaccccctatg |
20465589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #150
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 312
Target Start/End: Original strand, 23263183 - 23263219
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaa |
312 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
23263183 |
ttgcggttatggacccctaactaatttaaatacaaaa |
23263219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #151
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 23695564 - 23695612
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||| ||| ||||||| |||||||||||||||| |
|
|
| T |
23695564 |
ttgcggttatggacccctaattaaattaaataaaaaacagccccctatg |
23695612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #152
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 25631128 - 25631172
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||| |||| |
|
|
| T |
25631128 |
ggttatggacccctaactaatttaaatacaaaacagtcccttatg |
25631172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #153
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 26036289 - 26036321
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
26036289 |
ctaactaatttaaatacaaaacagccccctatg |
26036321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #154
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 28251653 - 28251605
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| | || |||||||||||||||||||||||| |||||||| |
|
|
| T |
28251653 |
ttgcggttatagccccctaactaatttaaatacaaaacagtcccctatg |
28251605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #155
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 33825638 - 33825686
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||| ||| ||||| |
|
|
| T |
33825638 |
ttgcggttatggacccctaactaatttaaatataaaacaaccctctatg |
33825686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #156
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 34082376 - 34082329
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
34082376 |
ttgcggttatgcacc-ctaactagtttaaatacaaaacagccccctatg |
34082329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #157
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 285 - 325
Target Start/End: Complemental strand, 38974944 - 38974904
Alignment:
| Q |
285 |
tggacctctaactaatttaaatacaaaacagccccctatgc |
325 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
38974944 |
tggacccctaactaattaaaatacaaaacagccccctatgc |
38974904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #158
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 276 - 315
Target Start/End: Complemental strand, 9072224 - 9072185
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacag |
315 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
9072224 |
ttgcggttatggccccctaactaatttaaatacaaaacag |
9072185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #159
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 269 - 324
Target Start/End: Original strand, 20039933 - 20039988
Alignment:
| Q |
269 |
ggcttaattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| || ||| ||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
20039933 |
ggcttaattgcacttttggccctctaactaattaaaatacaaaatagccccctatg |
20039988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #160
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 276 - 315
Target Start/End: Complemental strand, 28395208 - 28395169
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacag |
315 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
28395208 |
ttgcggttatggacccctaactaatttaaatgcaaaacag |
28395169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #161
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 276 - 323
Target Start/End: Original strand, 29401128 - 29401175
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| ||||||||||| |
|
|
| T |
29401128 |
ttgcggttatggacccataactaatttaaataaaaatcagccccctat |
29401175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #162
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 285 - 324
Target Start/End: Complemental strand, 37060164 - 37060125
Alignment:
| Q |
285 |
tggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
37060164 |
tggacccctaactaattaaaatacaaaacagccccctatg |
37060125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #163
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 276 - 319
Target Start/End: Complemental strand, 37333808 - 37333765
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccc |
319 |
Q |
| |
|
|||||||| ||| || |||||||||||||||||||||||||||| |
|
|
| T |
37333808 |
ttgcggttttggtcccctaactaatttaaatacaaaacagcccc |
37333765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #164
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 285 - 324
Target Start/End: Original strand, 38162640 - 38162679
Alignment:
| Q |
285 |
tggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
38162640 |
tggacccctaactaattaaaatacaaaacagccccctatg |
38162679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #165
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 276 - 314
Target Start/End: Complemental strand, 16860081 - 16860043
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaaca |
314 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
16860081 |
ttgcggttatggtcccctaactaatttaaatacaaaaca |
16860043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #166
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 319
Target Start/End: Complemental strand, 35818483 - 35818433
Alignment:
| Q |
269 |
ggcttaattgcggttatggacctctaactaatttaaatacaaaacagcccc |
319 |
Q |
| |
|
||||||||||| || |||||| ||| |||||||||||||||||||||||| |
|
|
| T |
35818483 |
ggcttaattgcacttttggacccctatctaatttaaatacaaaacagcccc |
35818433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #167
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 274 - 324
Target Start/End: Complemental strand, 41083367 - 41083317
Alignment:
| Q |
274 |
aattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||| || ||| ||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
41083367 |
aattgcgattttggccctctaactaattaaaatacaaaacaaccccctatg |
41083317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #168
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 274 - 324
Target Start/End: Complemental strand, 42779445 - 42779395
Alignment:
| Q |
274 |
aattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||| ||||||| || ||||| |
|
|
| T |
42779445 |
aattgtggttatggacccctaactaatttaaatataaaacagtccactatg |
42779395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #169
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 274 - 324
Target Start/End: Complemental strand, 43222968 - 43222918
Alignment:
| Q |
274 |
aattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| ||||| ||| || |||||||||| |||||||||||||||||||||| |
|
|
| T |
43222968 |
aattacggttttggccccctaactaattaaaatacaaaacagccccctatg |
43222918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #170
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 29560051 - 29560002
Alignment:
| Q |
276 |
ttgcggttatggacctc-taactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||| | ||||||||||||||||||||||||||| |||| |
|
|
| T |
29560051 |
ttgcggttatagaccccctaactaatttaaatacaaaacagccccttatg |
29560002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #171
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 10332246 - 10332214
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
10332246 |
ctaactaattaaaatacaaaacagccccctatg |
10332214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #172
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 12610533 - 12610501
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
12610533 |
ctaactaattaaaatacaaaacagccccctatg |
12610501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #173
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 279 - 323
Target Start/End: Complemental strand, 21347704 - 21347660
Alignment:
| Q |
279 |
cggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||| ||||||| |
|
|
| T |
21347704 |
cggttatggctccctaactaatttaaatacaaaacagtcccctat |
21347660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #174
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 26366025 - 26365993
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
26366025 |
ctaactaattaaaatacaaaacagccccctatg |
26365993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #175
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 32556020 - 32555972
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||| ||| |||| |
|
|
| T |
32556020 |
ttgcggttatggcctcctaactaatttaaatacaaaacagtcccttatg |
32555972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #176
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 33825870 - 33825826
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||| ||||| |
|
|
| T |
33825870 |
ggttatggatccataactaatttaaatacaaaacagccctctatg |
33825826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #177
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 41032461 - 41032413
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || | ||||||||||||||||||||||||| |||| |
|
|
| T |
41032461 |
ttgcggttatggccccatgactaatttaaatacaaaacagccccttatg |
41032413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #178
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 41083289 - 41083257
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
41083289 |
ctaactaattaaaatacaaaacagccccctatg |
41083257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0067 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: scaffold0067
Description:
Target: scaffold0067; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 260 - 324
Target Start/End: Original strand, 26184 - 26248
Alignment:
| Q |
260 |
taaaaaataggcttaattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||||||||||| || |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26184 |
taaaaaataggcttaattgcacttttggacccctaactaatttaaatacaaaacagccccctatg |
26248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 49; Significance: 5e-19; HSPs: 174)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 39976767 - 39976815
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39976767 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
39976815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 227995 - 228043
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
227995 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
228043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 930746 - 930794
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
930746 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
930794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 930983 - 930935
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
930983 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
930935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 5096826 - 5096874
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5096826 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
5096874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 7974427 - 7974475
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7974427 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
7974475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 7974666 - 7974618
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7974666 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
7974618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 9035637 - 9035589
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9035637 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
9035589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 10312502 - 10312454
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10312502 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
10312454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 11578093 - 11578141
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11578093 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
11578141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 11900325 - 11900277
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11900325 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
11900277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 18073854 - 18073902
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
18073854 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
18073902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 18296126 - 18296078
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
18296126 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
18296078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 18852533 - 18852581
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
18852533 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
18852581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 19194436 - 19194388
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
19194436 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
19194388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 23910130 - 23910082
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
23910130 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
23910082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 25983027 - 25983075
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
25983027 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
25983075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 25983266 - 25983218
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
25983266 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
25983218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 25986963 - 25987011
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
25986963 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
25987011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 25987198 - 25987150
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
25987198 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
25987150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 26612380 - 26612428
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26612380 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
26612428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 27512840 - 27512888
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
27512840 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
27512888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 30757262 - 30757310
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30757262 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
30757310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 35121451 - 35121499
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35121451 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
35121499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 35437244 - 35437292
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35437244 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
35437292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 35437489 - 35437441
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35437489 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
35437441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 35711933 - 35711885
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35711933 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
35711885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 35923930 - 35923978
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35923930 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
35923978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 36376098 - 36376146
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36376098 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
36376146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 37047703 - 37047751
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37047703 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
37047751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 37452324 - 37452276
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37452324 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
37452276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 38053188 - 38053232
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38053188 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
38053232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 39753910 - 39753958
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
39753910 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
39753958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 46622592 - 46622640
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
46622592 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
46622640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 48871363 - 48871315
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
48871363 |
ttgcggttatggacctctaattaatttaaatacaaaacagccccctatg |
48871315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 274 - 324
Target Start/End: Original strand, 47731738 - 47731788
Alignment:
| Q |
274 |
aattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
47731738 |
aattgcggttatggacccctaactaatttaaatacaaaacagcctcctatg |
47731788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 274 - 323
Target Start/End: Complemental strand, 5181708 - 5181659
Alignment:
| Q |
274 |
aattgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5181708 |
aattgcagttatggacccctaactaatttaaatacaaaacagccccctat |
5181659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 320
Target Start/End: Original strand, 9035396 - 9035440
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccc |
320 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9035396 |
ttgcggttatggacctctaactaatttaaatacaaaacaaccccc |
9035440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 11578331 - 11578283
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
11578331 |
ttgcggttatggatccctaactaatttaaatacaaaacagccccctatg |
11578283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 11900088 - 11900136
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
11900088 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccctatg |
11900136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 16537115 - 16537163
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
16537115 |
ttgcggttatggacccctaactaatttaaatataaaacagccccctatg |
16537163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 16628547 - 16628499
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
16628547 |
ttgcggttatggacccctaactaatttaaatataaaacagccccctatg |
16628499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 16879273 - 16879321
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
16879273 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccatatg |
16879321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 18074090 - 18074042
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
18074090 |
ttgcggttatggatccctaactaatttaaatacaaaacagccccctatg |
18074042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 18295890 - 18295938
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
18295890 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccctatg |
18295938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 18363569 - 18363521
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
18363569 |
ttgcggttatggatccctaactaatttaaatacaaaacagccccctatg |
18363521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 18852764 - 18852720
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
18852764 |
ggttatggacccctaactaatttaaatacaaaacagccccctatg |
18852720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 268 - 324
Target Start/End: Original strand, 18938969 - 18939025
Alignment:
| Q |
268 |
aggcttaattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
18938969 |
aggcttaattgcacttttggacccctaactaatttaaatacaaaacagccccctatg |
18939025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 20387591 - 20387639
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
20387591 |
ttgcagttatggacccctaactaatttaaatacaaaacagccccctatg |
20387639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 20387821 - 20387777
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
20387821 |
ggttatggacccctaactaatttaaatacaaaacagccccctatg |
20387777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 20392065 - 20392113
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
20392065 |
ttgcagttatggacccctaactaatttaaatacaaaacagccccctatg |
20392113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 20392295 - 20392251
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
20392295 |
ggttatggacccctaactaatttaaatacaaaacagccccctatg |
20392251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 21917124 - 21917172
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
21917124 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccctatg |
21917172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 23740540 - 23740492
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
23740540 |
ttgcggttatggacccctaactaatttaaatacaaaacagtcccctatg |
23740492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 24775896 - 24775852
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
24775896 |
ggttatggacccctaactaatttaaatacaaaacagccccctatg |
24775852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 26612618 - 26612570
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
26612618 |
ttgcggttatggacccctaattaatttaaatacaaaacagccccctatg |
26612570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 30028432 - 30028480
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
30028432 |
ttgcggttatggacctctaactaatttaaatacaaaataaccccctatg |
30028480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 30140958 - 30141006
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
30140958 |
ttgcggttatggacccctaactaatttaactacaaaacagccccctatg |
30141006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 30699299 - 30699251
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
30699299 |
ttgcggttatggacctctaactaatttaaatacaaaacaaccctctatg |
30699251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 32555576 - 32555528
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
32555576 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccctatg |
32555528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 34288086 - 34288134
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
34288086 |
ttgcggttatgaacccctaactaatttaaatacaaaacagccccctatg |
34288134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 34288326 - 34288278
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
34288326 |
ttgcggttatggacccctaactaatttaaatacaaaacagtcccctatg |
34288278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 35121688 - 35121640
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
35121688 |
ttgcggttatggacccctaactaatttaaatacaaaacatccccctatg |
35121640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 35924166 - 35924118
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35924166 |
ttgcagttatggacccctaactaatttaaatacaaaacagccccctatg |
35924118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 36376337 - 36376289
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
36376337 |
ttgcggttatggaaccctaactaatttaaatacaaaacagccccctatg |
36376289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 37047941 - 37047893
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
37047941 |
ttgcggttatggacccctaactaatttaaatacaaaacagccctctatg |
37047893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 38882408 - 38882456
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38882408 |
ttgcggttatgaacccctaactaatttaaatacaaaacagccccctatg |
38882456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 39754149 - 39754101
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
39754149 |
ttgcggttatggacccctaactaatttaaatacaaaacagtcccctatg |
39754101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 42751217 - 42751169
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42751217 |
ttgcggttatgaacccctaactaatttaaatacaaaacagccccctatg |
42751169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 42997094 - 42997142
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
42997094 |
ttgcggttatggacccctaactaatttaaatacaaaacagcctcctatg |
42997142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 44214701 - 44214745
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
44214701 |
ggttatggacccctaactaatttaaatacaaaacagccccctatg |
44214745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 45231795 - 45231747
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
45231795 |
ttgcagttatggacccctaactaatttaaatacaaaacagccccctatg |
45231747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 46622828 - 46622780
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
46622828 |
ttgcggttatggacccctaactaatttaaatacaaatcagccccctatg |
46622780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 276 - 323
Target Start/End: Complemental strand, 3235391 - 3235344
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
3235391 |
ttgcggttatggacccctaactaatttaaatacaaaatagccccctat |
3235344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 276 - 319
Target Start/End: Original strand, 3925831 - 3925874
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccc |
319 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3925831 |
ttgcggttatggacccctaactaatttaaatacaaaacagcccc |
3925874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 276 - 319
Target Start/End: Complemental strand, 30757499 - 30757456
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccc |
319 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30757499 |
ttgcggttatggacccctaactaatttaaatacaaaacagcccc |
30757456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 276 - 319
Target Start/End: Complemental strand, 34404710 - 34404667
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccc |
319 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34404710 |
ttgcggttatggacccctaactaatttaaatacaaaacagcccc |
34404667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 276 - 323
Target Start/End: Complemental strand, 38882648 - 38882601
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
38882648 |
ttgcggttatggacccctaactaatttaaatacaaaacagcctcctat |
38882601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 274 - 324
Target Start/End: Original strand, 34404479 - 34404529
Alignment:
| Q |
274 |
aattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| | ||||||||| |
|
|
| T |
34404479 |
aattgcggttatggacccctaactaatttaaatacaaaataaccccctatg |
34404529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 279 - 324
Target Start/End: Complemental strand, 10351078 - 10351033
Alignment:
| Q |
279 |
cggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
10351078 |
cggttatggacccctaactaatttaaatacaaaatagccccctatg |
10351033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 276 - 317
Target Start/End: Original strand, 21782641 - 21782682
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcc |
317 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
21782641 |
ttgcggttatggacccctaactaatttaaatacaaaacagcc |
21782682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 279 - 324
Target Start/End: Original strand, 45231563 - 45231608
Alignment:
| Q |
279 |
cggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
45231563 |
cggttatggatccctaactaatttaaatacaaaacagccccctatg |
45231608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 228233 - 228185
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
228233 |
ttgcggttttggacccctaactaatttaaatacaaaacaaccccctatg |
228185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 388176 - 388128
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | |||| |||||||||||||||||||||||||||| |
|
|
| T |
388176 |
ttgcggttatggatccctaattaatttaaatacaaaacagccccctatg |
388128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 497150 - 497198
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
497150 |
ttgcagttatggacccctaactaatttaaatacaaatcagccccctatg |
497198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 497387 - 497339
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| ||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
497387 |
ttgcgtttacggacccctaactaatttaaatacaaaacagccccctatg |
497339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 7195494 - 7195542
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| |||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
7195494 |
ttgcagttatggatccctaactaatttaaatacaaaacagccccctatg |
7195542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 7195733 - 7195685
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | |||||||||||||||| |||||||||||||||| |
|
|
| T |
7195733 |
ttgcggttatggatccctaactaatttaaatataaaacagccccctatg |
7195685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 10356155 - 10356203
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||| ||||||||| |
|
|
| T |
10356155 |
ttgcggttatggccccctaactaatttaaatacaaaacaaccccctatg |
10356203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 10385507 - 10385555
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
10385507 |
ttgcggttatggcctcctaactaatttaaatacaaaacagccccctatg |
10385555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 17757808 - 17757856
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||| ||||||||||| |
|
|
| T |
17757808 |
ttgcggttatggacccctaattaatttaaatacaaaatagccccctatg |
17757856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 18798285 - 18798237
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| | || ||||||||||||||||||||||||||||||||| |
|
|
| T |
18798285 |
ttgcggttatagccccctaactaatttaaatacaaaacagccccctatg |
18798237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 19194198 - 19194246
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
19194198 |
ttgcggttatagacccctaactaatttaaatacataacagccccctatg |
19194246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 19778529 - 19778482
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
19778529 |
ttgcggttatg-acccctaactaatttaaatacaaaacagccccctatg |
19778482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 23740302 - 23740350
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
23740302 |
ttgcggttatggacccttaattaatttaaatacaaaacagccccctatg |
23740350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 23909933 - 23909981
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||| |||| |
|
|
| T |
23909933 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccatatg |
23909981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 24236152 - 24236200
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||||| |||| |
|
|
| T |
24236152 |
ttgcggttatggacccctaactaatttatatacaaaacagccccttatg |
24236200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 24236383 - 24236335
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| | ||||||| |
|
|
| T |
24236383 |
ttgcggttatggacccctaactaatttaaatacaaaacaacaccctatg |
24236335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 26872635 - 26872587
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
26872635 |
ttgcggttatgaccctctaactaatttaaatacaaaacagtcccctatg |
26872587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 27432528 - 27432576
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||||| |||||| |
|
|
| T |
27432528 |
ttgcggttatggacccctaactaatttaaatacaaagcagccgcctatg |
27432576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 30028654 - 30028610
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
30028654 |
ggttatggatccctaactaatttaaatacaaaacagccccctatg |
30028610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 30141195 - 30141147
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
30141195 |
ttgcggttatagacccctaactaatttaaatacaaaacaaccccctatg |
30141147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 30699061 - 30699109
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
30699061 |
ttgcagttatggacccctaactaatttaaatacaaaacagtcccctatg |
30699109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 34533256 - 34533300
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
34533256 |
ggttatgaacccctaactaatttaaatacaaaacagccccctatg |
34533300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 34533488 - 34533440
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||| |||| |
|
|
| T |
34533488 |
ttgcggttatggacccctaactaatttaaatacaaaacagtcccttatg |
34533440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 35711696 - 35711744
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
35711696 |
ttgcggttatggacccctaactaatttaaatacaaaacaatcccctatg |
35711744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 37996055 - 37996103
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||| ||||| |
|
|
| T |
37996055 |
ttgcggttatggacccctaactaatttaaatacaaaacaacccactatg |
37996103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 37996286 - 37996238
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||| |||||| |
|
|
| T |
37996286 |
ttgcggttatggacccctaactaatttaaatgcaaaacagcctcctatg |
37996238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 38053423 - 38053375
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| || |||||||| |
|
|
| T |
38053423 |
ttgcggttatggacccctaactaatttaaatacaaaagagtcccctatg |
38053375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 38445446 - 38445490
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
38445446 |
ggttatggacccctaactaatttaaatacaaaacaaccccctatg |
38445490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 38445681 - 38445633
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||| ||||||||| |
|
|
| T |
38445681 |
ttgcggttatggacccctaactagtttaaatacaaaacaaccccctatg |
38445633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 38879199 - 38879247
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||||| |||||| |
|
|
| T |
38879199 |
ttgcggttatggacccctagctaatttaaatacaaaacagcctcctatg |
38879247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 40436074 - 40436122
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
40436074 |
ttgcggttatgaccccctaactaatttaaatacaaaacagccccctatg |
40436122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 40436251 - 40436203
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| |||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
40436251 |
ttgcgattatggccccctaactaatttaaatacaaaacagccccctatg |
40436203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 42750985 - 42751029
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42750985 |
ggttatggatctctaactaatttaaatacaaaacatccccctatg |
42751029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 43408262 - 43408310
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
43408262 |
ttgcggttatggtcacctaactaatttaaatacaaaacagccccctatg |
43408310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 44189443 - 44189491
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
44189443 |
ttgcggttatggcctcctaactaatttaaatacaaaacagccccctatg |
44189491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 44215003 - 44214955
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| | ||||||||| |
|
|
| T |
44215003 |
ttgcggttatggacccctaactaatttaaatacaaaataaccccctatg |
44214955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 47731978 - 47731930
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
47731978 |
ttgcggttatggacccataactaatttaaatacaaaacagcctcctatg |
47731930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 276 - 319
Target Start/End: Complemental strand, 3926033 - 3925990
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccc |
319 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
3926033 |
ttgcggttatggacccctaactaatttaaatacaaaacaacccc |
3925990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 276 - 319
Target Start/End: Complemental strand, 4061263 - 4061220
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccc |
319 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
4061263 |
ttgcggttatggacccctaactaatttaaatacaaaacaacccc |
4061220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 276 - 319
Target Start/End: Complemental strand, 10319168 - 10319125
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccc |
319 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10319168 |
ttgcggttatggacccttaactaatttaaatacaaaacagcccc |
10319125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 276 - 319
Target Start/End: Original strand, 19233378 - 19233421
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccc |
319 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
19233378 |
ttgcggttatggccccctaactaatttaaatacaaaacagcccc |
19233421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 276 - 319
Target Start/End: Complemental strand, 27513076 - 27513033
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccc |
319 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
27513076 |
ttgcggttatggacccttaactaatttaaatacaaaacagcccc |
27513033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 276 - 319
Target Start/End: Original strand, 37452089 - 37452132
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccc |
319 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
37452089 |
ttgcggttatggatccctaactaatttaaatacaaaacagcccc |
37452132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 276 - 323
Target Start/End: Complemental strand, 43408479 - 43408433
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
43408479 |
ttgcggttatggccc-ctaactaatttaaatacaaaacagccccctat |
43408433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 276 - 322
Target Start/End: Complemental strand, 42997327 - 42997281
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccccta |
322 |
Q |
| |
|
|||||||||| || | ||||||||||||||||||||||||||||||| |
|
|
| T |
42997327 |
ttgcggttatagatccctaactaatttaaatacaaaacagcccccta |
42997281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 267 - 324
Target Start/End: Original strand, 32555333 - 32555390
Alignment:
| Q |
267 |
taggcttaattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| || |||||| ||||||||||||| ||||||||| ||||||||| |
|
|
| T |
32555333 |
taggcttaattgcacttttggacccctaactaatttaagtacaaaacatccccctatg |
32555390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 1450418 - 1450370
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| || |||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
1450418 |
ttgcgattttggacccctaactaattaaaatacaaaacagccccctatg |
1450370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 3235168 - 3235200
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
3235168 |
ctaactaatttaaatacaaaacagccccctatg |
3235200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 4061026 - 4061074
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||| |||||| |||||||||||||||| ||||||||| |
|
|
| T |
4061026 |
ttgcggttatgaacccctaactgatttaaatacaaaacaaccccctatg |
4061074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 5097056 - 5097012
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||| |||||||| |
|
|
| T |
5097056 |
ggttatggacccctaactaatttaaatataaaacagtcccctatg |
5097012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 10318929 - 10318977
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| |||||| ||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
10318929 |
ttgcagttatgaacccctaactaatttaaatacaaaacagtcccctatg |
10318977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 10356373 - 10356325
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || |||||||||| ||||||||||||||||||||| |
|
|
| T |
10356373 |
ttgcggttatggccccttaactaatttgaatacaaaacagccccctatg |
10356325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 11275440 - 11275392
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || |||||||| |||||||||||||| ||||||||| |
|
|
| T |
11275440 |
ttgcggttatggccccctaactaaattaaatacaaaacaaccccctatg |
11275392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 16537348 - 16537304
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
16537348 |
ggttatggactcctaactaatttaaatacaaaatagccccctatg |
16537304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 16628314 - 16628358
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
16628314 |
ggttatggactcctaactaatttaaatacaaaatagccccctatg |
16628358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 16879513 - 16879465
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||||||| |||| |
|
|
| T |
16879513 |
ttgcggttatggactcctagctaatttaaatacaaaacagccccttatg |
16879465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 18363333 - 18363381
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||||| ||| |||| |
|
|
| T |
18363333 |
ttgcgattatggacccctaactaatttaaatacaaaacagtcccatatg |
18363381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 19233594 - 19233546
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||| ||||||||||| |
|
|
| T |
19233594 |
ttgcggttatggccccataactaatttaaatacaaaatagccccctatg |
19233546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 21782874 - 21782830
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||| |||| |
|
|
| T |
21782874 |
ggttatggacccctaactaatttaaatacaaaacaaccccttatg |
21782830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 23358737 - 23358785
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
23358737 |
ttgcggctgtggacctctaactaatttaaatacaaaatagtcccctatg |
23358785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 25036070 - 25036118
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | |||||||||||||||| |||||| ||||||||| |
|
|
| T |
25036070 |
ttgcggttatggatccctaactaatttaaatataaaacaaccccctatg |
25036118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 25036292 - 25036260
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
25036292 |
ctaactaatttaaatacaaaacagccccctatg |
25036260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 26872435 - 26872467
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
26872435 |
ctaactaatttaaatacaaaacagccccctatg |
26872467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 30401179 - 30401135
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||| |||||||| |
|
|
| T |
30401179 |
ggttatggccccctaactaatttaaatacaaaacagtcccctatg |
30401135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 38879425 - 38879377
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||| |||||| | || |||||||||||||||||||||||||||||| |
|
|
| T |
38879425 |
ttgcggctatggatccctgactaatttaaatacaaaacagccccctatg |
38879377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 45480104 - 45480056
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| || ||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45480104 |
ttgcgattttggtcctctaactaattaaaatacaaaacagccccctatg |
45480056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #149
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 276 - 323
Target Start/End: Complemental strand, 9629291 - 9629244
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||| ||| |||| |
|
|
| T |
9629291 |
ttgcggttatggacccctaactaatttaaatataaaacaaccctctat |
9629244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #150
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 289 - 324
Target Start/End: Original strand, 30503758 - 30503793
Alignment:
| Q |
289 |
cctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30503758 |
cctctaactaattaaaatacaaaacagccccctatg |
30503793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #151
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 274 - 317
Target Start/End: Original strand, 43632377 - 43632420
Alignment:
| Q |
274 |
aattgcggttatggacctctaactaatttaaatacaaaacagcc |
317 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
43632377 |
aattgcggttatggcctcctaactaatttaaatacaaaacagcc |
43632420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #152
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 285 - 324
Target Start/End: Original strand, 45260000 - 45260039
Alignment:
| Q |
285 |
tggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
45260000 |
tggacctctaactaattaaaatacaaaacagccccatatg |
45260039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #153
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 280 - 314
Target Start/End: Original strand, 10350848 - 10350882
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaaca |
314 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10350848 |
ggttatggacccctaactaatttaaatacaaaaca |
10350882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #154
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 274 - 324
Target Start/End: Complemental strand, 39977005 - 39976955
Alignment:
| Q |
274 |
aattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| |||||||| | | |||||||||||||||||||||||||||| |||| |
|
|
| T |
39977005 |
aattacggttatgaatccctaactaatttaaatacaaaacagccccttatg |
39976955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #155
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 292 - 321
Target Start/End: Original strand, 3931700 - 3931729
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccct |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3931700 |
ctaactaatttaaatacaaaacagccccct |
3931729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #156
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 279 - 324
Target Start/End: Complemental strand, 10986252 - 10986207
Alignment:
| Q |
279 |
cggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||| ||||| |
|
|
| T |
10986252 |
cggttatgatcccctaactaatttaaatacaaaacagccctctatg |
10986207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #157
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 276 - 309
Target Start/End: Complemental strand, 21917525 - 21917492
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaataca |
309 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
21917525 |
ttgcggttatggacccctaactaatttaaataca |
21917492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #158
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 287 - 324
Target Start/End: Complemental strand, 41930916 - 41930879
Alignment:
| Q |
287 |
gacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
41930916 |
gacctctaactaattaaaatataaaacagccccctatg |
41930879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #159
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 784556 - 784588
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
784556 |
ctaactaattaaaatacaaaacagccccctatg |
784588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #160
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 1450037 - 1450069
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
1450037 |
ctaactaattaaaatacaaaacagccccctatg |
1450069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #161
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 316
Target Start/End: Original strand, 9629050 - 9629090
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagc |
316 |
Q |
| |
|
||||||||||||| | |||||||||||||||| |||||||| |
|
|
| T |
9629050 |
ttgcggttatggaaccctaactaatttaaatataaaacagc |
9629090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #162
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 10986053 - 10986085
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
10986053 |
ctaactaatttaaatacaaaacagccccttatg |
10986085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #163
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 16705711 - 16705663
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| | || |||||||||||||||||||||| | |||||||| |
|
|
| T |
16705711 |
ttgcggttatcgccccctaactaatttaaatacaaaactgtcccctatg |
16705663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #164
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 17679947 - 17679899
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| | || |||||||||||||||||||||| | |||||||| |
|
|
| T |
17679947 |
ttgcggttatcgccccctaactaatttaaatacaaaactgtcccctatg |
17679899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #165
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 18201408 - 18201440
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
18201408 |
ctaactaattcaaatacaaaacagccccctatg |
18201440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #166
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 20588414 - 20588382
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
20588414 |
ctaactaattaaaatacaaaacagccccctatg |
20588382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #167
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 30505141 - 30505109
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
30505141 |
ctaactaattaaaatacaaaacagccccctatg |
30505109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #168
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 31530028 - 31530060
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
31530028 |
ctaactaattaaaatacaaaacagccccctatg |
31530060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #169
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 31530378 - 31530346
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
31530378 |
ctaactaattaaaatacaaaacagccccctatg |
31530346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #170
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 40790930 - 40790898
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
40790930 |
ctaactaattaaaatacaaaacagccccctatg |
40790898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #171
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 42437976 - 42437944
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
42437976 |
ctaactaattaaaatacaaaacagccccctatg |
42437944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #172
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 45260240 - 45260192
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| || |||||| |||||||||| ||||||||||||| |||||||| |
|
|
| T |
45260240 |
ttgcgattttggacccctaactaattaaaatacaaaacagtcccctatg |
45260192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #173
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 45863230 - 45863198
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
45863230 |
ctaactaattaaaatacaaaacagccccctatg |
45863198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #174
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 49081608 - 49081560
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| | |||| ||||||||||||||||||| |||||||| |
|
|
| T |
49081608 |
ttgcggttatggcctcctaattaatttaaatacaaaacagtcccctatg |
49081560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 49; Significance: 5e-19; HSPs: 116)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 34705651 - 34705603
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34705651 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
34705603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 276 - 323
Target Start/End: Original strand, 10255559 - 10255606
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10255559 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
10255606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 1815251 - 1815203
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1815251 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
1815203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 3185432 - 3185384
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3185432 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
3185384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 3194711 - 3194663
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3194711 |
ttgcggttatggatctctaactaatttaaatacaaaacagccccctatg |
3194663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 5606334 - 5606382
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5606334 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
5606382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 5606572 - 5606524
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5606572 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
5606524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 7391523 - 7391571
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7391523 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
7391571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 7391752 - 7391704
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7391752 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
7391704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 9703819 - 9703771
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9703819 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
9703771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 11322300 - 11322252
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11322300 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
11322252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 11614936 - 11614984
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11614936 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
11614984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 11615174 - 11615126
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11615174 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
11615126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 12257039 - 12256991
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12257039 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
12256991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 15150003 - 15149955
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
15150003 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
15149955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 20630624 - 20630576
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
20630624 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
20630576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 23883127 - 23883175
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
23883127 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
23883175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 23883363 - 23883315
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
23883363 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
23883315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 26171482 - 26171434
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26171482 |
ttgcgattatggacctctaactaatttaaatacaaaacagccccctatg |
26171434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 27771489 - 27771441
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
27771489 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
27771441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 30965967 - 30965919
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30965967 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
30965919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 276 - 323
Target Start/End: Original strand, 13042446 - 13042493
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
13042446 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctat |
13042493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 274 - 324
Target Start/End: Complemental strand, 11446254 - 11446204
Alignment:
| Q |
274 |
aattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
11446254 |
aattgcggttatggatccctaactaatttaaatacaaaacagccccctatg |
11446204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 274 - 324
Target Start/End: Complemental strand, 22279775 - 22279725
Alignment:
| Q |
274 |
aattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
22279775 |
aattgcggttatggactcctaactaatttaaatacaaaacagccccctatg |
22279725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 274 - 319
Target Start/End: Complemental strand, 31833543 - 31833498
Alignment:
| Q |
274 |
aattgcggttatggacctctaactaatttaaatacaaaacagcccc |
319 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31833543 |
aattgcggttatggacccctaactaatttaaatacaaaacagcccc |
31833498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 1815014 - 1815062
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
1815014 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccctatg |
1815062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 6261652 - 6261604
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
6261652 |
ttgcggttatggacccctaactaatttaaatacaaaacagtcccctatg |
6261604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 10893927 - 10893975
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
10893927 |
ttgcggttatggccccctaactaatttaaatacaaaacagccccctatg |
10893975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 10977696 - 10977744
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
10977696 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccctatg |
10977744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 10977933 - 10977885
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10977933 |
ttgcggttatggacccttaactaatttaaatacaaaacagccccctatg |
10977885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 11213458 - 11213410
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
11213458 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccctatg |
11213410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 11321944 - 11321988
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11321944 |
ggttatggacccctaactaatttaaatacaaaacagccccctatg |
11321988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 11322060 - 11322108
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
11322060 |
ttgcggttatggacccctaactaatttaaatacaaaacagccctctatg |
11322108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 11446014 - 11446062
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
11446014 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccttatg |
11446062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 11746036 - 11746084
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
11746036 |
ttgcggttatggtcccctaactaatttaaatacaaaacagccccctatg |
11746084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 12256802 - 12256850
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
12256802 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccctatg |
12256850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 13440151 - 13440103
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
13440151 |
ttgcggttacggacccctaactaatttaaatacaaaacagccccctatg |
13440103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 14997047 - 14997095
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
14997047 |
ttgcggttatggacccctaactaatttaactacaaaacagccccctatg |
14997095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 15149765 - 15149813
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
15149765 |
ttgcggttatggactcctaactaatttaaatacaaaacagccccctatg |
15149813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 15711911 - 15711863
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
15711911 |
ttgcggttatggacccctaattaatttaaatacaaaacagccccctatg |
15711863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 18683054 - 18683098
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
18683054 |
ggttatggacccctaactaatttaaatacaaaacagccccctatg |
18683098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 20630390 - 20630438
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
20630390 |
ttgcggttatagacccctaactaatttaaatacaaaacagccccctatg |
20630438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 23291294 - 23291342
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
23291294 |
ttgcggttatggacccctaactaatttaaatacaaaacagtcccctatg |
23291342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 28563365 - 28563413
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
28563365 |
ttgcggttatggacccctaactaatttaaatacaaaacagtcccctatg |
28563413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 28563595 - 28563547
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
28563595 |
ttgcggttatggacccctaactaatttaaatacaaaacagacccctatg |
28563547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 29696886 - 29696934
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
29696886 |
ttgcggttatggacccctaattaatttaaatacaaaacagccccctatg |
29696934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 30818256 - 30818304
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30818256 |
ttgcggttatggactcctaactaatttaaatacaaaacagccccctatg |
30818304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 30818490 - 30818442
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
30818490 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccatatg |
30818442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 31951476 - 31951428
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
31951476 |
ttgcggttatggacacctaactaatttaaatacaaaacagccccctatg |
31951428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 265 - 324
Target Start/End: Complemental strand, 7324940 - 7324881
Alignment:
| Q |
265 |
aataggcttaattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| || |||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
7324940 |
aataggcttaattgcacttttggacccctaattaatttaaatacaaaacagccccctatg |
7324881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 276 - 323
Target Start/End: Complemental strand, 10894145 - 10894098
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
10894145 |
ttgcggttatggccccctaactaatttaaatacaaaacagccccctat |
10894098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 276 - 323
Target Start/End: Original strand, 13439915 - 13439962
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
13439915 |
ttgcgtttatggacccctaactaatttaaatacaaaacagccccctat |
13439962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 276 - 323
Target Start/End: Original strand, 15711673 - 15711720
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
15711673 |
ttgcggttatggatccctaactaatttaaatacaaaacagccccctat |
15711720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 267 - 324
Target Start/End: Original strand, 26171237 - 26171294
Alignment:
| Q |
267 |
taggcttaattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| || |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
26171237 |
taggcttaattgcacttttggacccgtaactaatttaaatacaaaacagccccctatg |
26171294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 274 - 323
Target Start/End: Original strand, 33720031 - 33720080
Alignment:
| Q |
274 |
aattgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
|||||| |||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
33720031 |
aattgcagttatggatccctaactaatttaaatacaaaacagccccctat |
33720080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 2565116 - 2565164
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||| ||||||||| |
|
|
| T |
2565116 |
ttgcggttatggatccctaactaatttaaatacaaaacaaccccctatg |
2565164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 3534836 - 3534884
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||| |||| |
|
|
| T |
3534836 |
ttgcggttatggtcccctaactaatttaaatacaaaacagccccatatg |
3534884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 6261419 - 6261467
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||| |||||||||| |
|
|
| T |
6261419 |
ttgcggttatggacccctaactaatataaatacaaaactgccccctatg |
6261467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 7324693 - 7324741
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| || | ||||||||||||||||||||||||||||||||| |
|
|
| T |
7324693 |
ttgcggttatagatccctaactaatttaaatacaaaacagccccctatg |
7324741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 11746254 - 11746206
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||| ||||||||| |
|
|
| T |
11746254 |
ttgcggttatggccccctaactaatttaaatacaaaacaaccccctatg |
11746206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 14997284 - 14997236
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
14997284 |
ttgcggttatagacccctaactaatttaaatacaaaacaaccccctatg |
14997236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 17965881 - 17965925
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
17965881 |
ggttatggacccctaactaatttaaatacaaaacagccctctatg |
17965925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 20080156 - 20080204
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||| |||| |
|
|
| T |
20080156 |
ttgcggttatggccccctaactaatttaaatacaaaacagccccatatg |
20080204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 20080374 - 20080326
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || |||| |||||||||||||||||||||||||||| |
|
|
| T |
20080374 |
ttgcggttatggccccctaattaatttaaatacaaaacagccccctatg |
20080326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 22279537 - 22279585
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||||||| ||||| |
|
|
| T |
22279537 |
ttgcggttatggacccctaactaatttaaatactaaacagcccgctatg |
22279585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 316
Target Start/End: Complemental strand, 23291531 - 23291491
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagc |
316 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
23291531 |
ttgcggttatggacccctaactaatttaaatacaaaacagc |
23291491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 25749993 - 25750041
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||| ||||||||| |
|
|
| T |
25749993 |
ttgcggttatggccccctaactaatttaaatacaaaacaaccccctatg |
25750041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 26716646 - 26716598
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || |||||||| |||||||||||||||||||||||| |
|
|
| T |
26716646 |
ttgcggttatggccccctaactaacttaaatacaaaacagccccctatg |
26716598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 27223580 - 27223536
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
27223580 |
ggttatggacccctaactaatttaaatacaaaacaaccccctatg |
27223536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 28930502 - 28930550
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
28930502 |
ttgcggttatggacccttaactaatttaaatacaaaacagcctcctatg |
28930550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 28930739 - 28930691
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
28930739 |
ttgcggttatcgacccttaactaatttaaatacaaaacagccccctatg |
28930691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 31740811 - 31740855
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
31740811 |
ggttatggacccctaattaatttaaatacaaaacagccccctatg |
31740855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 31741046 - 31740998
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
31741046 |
ttgcggttatgaacccctaactaatttaaatacaaaacaaccccctatg |
31740998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 31951243 - 31951291
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||||| ||||| |
|
|
| T |
31951243 |
ttgcggttatggacccccaactaatttaaatacaaaacagccctctatg |
31951291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 276 - 323
Target Start/End: Complemental strand, 15273254 - 15273207
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||| ||||||| |
|
|
| T |
15273254 |
ttgcggttatggccccctaactaatttaaatacaaaacagtcccctat |
15273207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 276 - 319
Target Start/End: Original strand, 30965729 - 30965772
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccc |
319 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30965729 |
ttgcagttatggacccctaactaatttaaatacaaaacagcccc |
30965772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 276 - 318
Target Start/End: Complemental strand, 30239479 - 30239437
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccc |
318 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30239479 |
ttgcagttatggacccctaactaatttaaatacaaaacagccc |
30239437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 287 - 320
Target Start/End: Original strand, 24897139 - 24897172
Alignment:
| Q |
287 |
gacctctaactaatttaaatacaaaacagccccc |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
24897139 |
gacctctaactaatttaaatacaaaacagccccc |
24897172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 1897154 - 1897106
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||||||| |||| |
|
|
| T |
1897154 |
ttgcggttatgaccccctaactaatttaaatacaaaacagccccttatg |
1897106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 2100418 - 2100466
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| | | |||||||||||||||||||||||| |||||||| |
|
|
| T |
2100418 |
ttgcggttatgaatccctaactaatttaaatacaaaacagtcccctatg |
2100466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 3535054 - 3535006
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||| |||||||||||||||| |||||||| |
|
|
| T |
3535054 |
ttgcggttatggccccctaactattttaaatacaaaacagacccctatg |
3535006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 9067506 - 9067538
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
9067506 |
ctaactaatttaaatacaaaacagccccctatg |
9067538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 11277664 - 11277712
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| || | ||||||||||||||||||||| ||||||||||| |
|
|
| T |
11277664 |
ttgcggttatagatccctaactaatttaaatacaaaatagccccctatg |
11277712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 11277892 - 11277844
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||| | |||||||||||||||||||||||||||||| |
|
|
| T |
11277892 |
ttgcggttatgaacccttgactaatttaaatacaaaacagccccctatg |
11277844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 13042683 - 13042635
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||| |||||| |||| |
|
|
| T |
13042683 |
ttgcggttatggatccctaactaatttaaatacaaaatagccccttatg |
13042635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 15273036 - 15273084
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||||||| ||||| |
|
|
| T |
15273036 |
ttgcggttatggctccctaactaatttaaatacaaaacagccctctatg |
15273084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 320
Target Start/End: Original strand, 16765079 - 16765123
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccc |
320 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||| ||||| |
|
|
| T |
16765079 |
ttgcggttatgcacccctaactaatttaaatacaaaacaaccccc |
16765123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 16765309 - 16765265
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||| ||||| |
|
|
| T |
16765309 |
ggttatggacccctaattaatttaaatacaaaacagccctctatg |
16765265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 17966113 - 17966065
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||| |||| |||||| |
|
|
| T |
17966113 |
ttgcggttatgaacccctaactaatttaaatacaaaaaagcctcctatg |
17966065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 18683285 - 18683237
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||| |||| |||| |
|
|
| T |
18683285 |
ttgcggttatggacccctaattaatttaaatacaaaacaaccccatatg |
18683237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 21003406 - 21003454
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||| ||| |||| |
|
|
| T |
21003406 |
ttgcggttacggacccctaactaatttaaatacaaaacagacccttatg |
21003454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 21008769 - 21008813
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||| ||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
21008769 |
ggttatgaacccctaactaatttaaatataaaacagccccctatg |
21008813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 269 - 324
Target Start/End: Original strand, 929207 - 929262
Alignment:
| Q |
269 |
ggcttaattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| || ||| || |||||||||| |||||||||||||||||||||| |
|
|
| T |
929207 |
ggcttaattgcacttttggccccctaactaattaaaatacaaaacagccccctatg |
929262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 285 - 324
Target Start/End: Original strand, 2017219 - 2017258
Alignment:
| Q |
285 |
tggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
2017219 |
tggacccctaactaattaaaatacaaaacagccccctatg |
2017258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 292 - 323
Target Start/End: Original strand, 3185287 - 3185318
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
3185287 |
ctaactaatttaaatacaaaacagccccctat |
3185318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 265 - 324
Target Start/End: Original strand, 28771686 - 28771745
Alignment:
| Q |
265 |
aataggcttaattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| || | | || |||||||||| |||||||||||||||||||||| |
|
|
| T |
28771686 |
aataggcttaattgcaattttagccccctaactaattaaaatacaaaacagccccctatg |
28771745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 276 - 322
Target Start/End: Complemental strand, 4793852 - 4793806
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccccta |
322 |
Q |
| |
|
||||| || |||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
4793852 |
ttgcgattttggacccctaactaattaaaatacaaaacagcccccta |
4793806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 276 - 314
Target Start/End: Complemental strand, 16735840 - 16735802
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaaca |
314 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
16735840 |
ttgcggttatggacccttaactaatttaaatacaaaaca |
16735802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 274 - 324
Target Start/End: Complemental strand, 21004400 - 21004350
Alignment:
| Q |
274 |
aattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| ||||| ||||| |||||||||||||||||||||||| ||| |||| |
|
|
| T |
21004400 |
aattgtggttacggacccctaactaatttaaatacaaaacagacccttatg |
21004350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 290 - 324
Target Start/End: Complemental strand, 26479302 - 26479268
Alignment:
| Q |
290 |
ctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
26479302 |
ctctaactaatttaaatacaaaacagctccctatg |
26479268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 276 - 322
Target Start/End: Original strand, 33265124 - 33265170
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccccta |
322 |
Q |
| |
|
||||| || ||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
33265124 |
ttgcgattttggtcctctaactaattaaaatacaaaacagcccccta |
33265170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 2018457 - 2018425
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
2018457 |
ctaactaattaaaatacaaaacagccccctatg |
2018425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 280 - 312
Target Start/End: Complemental strand, 2100652 - 2100620
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaa |
312 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
2100652 |
ggttatggacccctaactaatttaaatacaaaa |
2100620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 2565354 - 2565306
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | ||||||||||||| |||||||||||| ||||| |
|
|
| T |
2565354 |
ttgcggttatggatccttaactaatttaaacacaaaacagccctctatg |
2565306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #105
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 3195754 - 3195802
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | |||| ||||||||||||||||||| || ||||| |
|
|
| T |
3195754 |
ttgcggttatggatccctaattaatttaaatacaaaacagtcctctatg |
3195802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #106
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 9067707 - 9067659
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||| ||| ||||| |
|
|
| T |
9067707 |
ttgcggttatgaccccctaactaatttaaatacaaaacaaccctctatg |
9067659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #107
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 12730360 - 12730392
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
12730360 |
ctaactaattaaaatacaaaacagccccctatg |
12730392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #108
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 21009005 - 21008973
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
21009005 |
ctaactaatttaaatacaaaacaaccccctatg |
21008973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #109
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 22517493 - 22517461
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
22517493 |
ctaactaattaaaatacaaaacagccccctatg |
22517461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #110
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 23350179 - 23350147
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
23350179 |
ctaactaattaaaatacaaaacagccccctatg |
23350147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #111
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 28960281 - 28960313
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
28960281 |
ctaactaattaaaatacaaaacagccccctatg |
28960313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #112
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 29697118 - 29697070
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| |||||||||| |||| ||||||||||||||||| ||||| |||| |
|
|
| T |
29697118 |
ttgcagttatggacccctaattaatttaaatacaaaactgccccttatg |
29697070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #113
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 29873097 - 29873129
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
29873097 |
ctaactaattaaaatacaaaacagccccctatg |
29873129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #114
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 31175841 - 31175793
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| || ||| ||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
31175841 |
ttgcgattttggccctctaactaattaaaatacaaaacagtcccctatg |
31175793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #115
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 287 - 319
Target Start/End: Original strand, 33129449 - 33129481
Alignment:
| Q |
287 |
gacctctaactaatttaaatacaaaacagcccc |
319 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
33129449 |
gacctctaactaattaaaatacaaaacagcccc |
33129481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #116
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 34705414 - 34705462
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||| |||||| ||| |||||||||||||||||| ||||||||| |
|
|
| T |
34705414 |
ttgcggttctggacccttaattaatttaaatacaaaacaaccccctatg |
34705462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 49; Significance: 5e-19; HSPs: 195)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 34158748 - 34158700
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34158748 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
34158700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 274 - 324
Target Start/End: Original strand, 34158507 - 34158557
Alignment:
| Q |
274 |
aattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
34158507 |
aattgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
34158557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 274 - 324
Target Start/End: Complemental strand, 38371541 - 38371491
Alignment:
| Q |
274 |
aattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38371541 |
aattgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
38371491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 274 - 324
Target Start/End: Original strand, 41787085 - 41787135
Alignment:
| Q |
274 |
aattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
41787085 |
aattgcggttatggccctctaactaatttaaatacaaaacagccccctatg |
41787135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 104238 - 104286
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
104238 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
104286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 104475 - 104427
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
104475 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
104427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 6387007 - 6386959
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6387007 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
6386959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 6768835 - 6768883
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6768835 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
6768883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 7119632 - 7119680
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7119632 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
7119680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 7644495 - 7644543
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7644495 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
7644543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 7644734 - 7644686
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7644734 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
7644686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 7705864 - 7705816
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7705864 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
7705816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 8891692 - 8891740
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8891692 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
8891740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 17262128 - 17262176
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
17262128 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
17262176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 17262360 - 17262312
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
17262360 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
17262312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 17554083 - 17554131
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
17554083 |
ttgcggttatggacctctaactaatttaaatacaaaacagccacctatg |
17554131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 20466423 - 20466471
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
20466423 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
20466471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 20466660 - 20466612
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
20466660 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
20466612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 20472587 - 20472635
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
20472587 |
ttgcggttatggacctctaactaatttaaatacaaaatagccccctatg |
20472635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 20472821 - 20472773
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
20472821 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
20472773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 20473986 - 20473938
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
20473986 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
20473938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 23315653 - 23315605
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
23315653 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
23315605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 26675091 - 26675139
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26675091 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
26675139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 27246897 - 27246945
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
27246897 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
27246945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 31209262 - 31209310
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
31209262 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
31209310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 31209493 - 31209445
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
31209493 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
31209445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 31250744 - 31250696
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
31250744 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
31250696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 35364234 - 35364282
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35364234 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
35364282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 37289493 - 37289541
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37289493 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
37289541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 37289731 - 37289683
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37289731 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
37289683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 41707756 - 41707804
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41707756 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
41707804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 42672343 - 42672295
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42672343 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
42672295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 48278191 - 48278143
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
48278191 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
48278143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 51537468 - 51537516
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
51537468 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
51537516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 51696804 - 51696756
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
51696804 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
51696756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 52045759 - 52045807
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
52045759 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
52045807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 52114409 - 52114361
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
52114409 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
52114361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 54215994 - 54216042
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
54215994 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
54216042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 54556652 - 54556700
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
54556652 |
ttgcggttatggacctctaactaatttaaatacaaaacaaccccctatg |
54556700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 55586654 - 55586702
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
55586654 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
55586702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 276 - 323
Target Start/End: Original strand, 34957415 - 34957462
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34957415 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctat |
34957462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 276 - 323
Target Start/End: Complemental strand, 45289775 - 45289728
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45289775 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctat |
45289728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 277 - 324
Target Start/End: Original strand, 52114174 - 52114221
Alignment:
| Q |
277 |
tgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52114174 |
tgcggttatagacctctaactaatttaaatacaaaacagccccctatg |
52114221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 279 - 324
Target Start/End: Original strand, 24542795 - 24542840
Alignment:
| Q |
279 |
cggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
24542795 |
cggttatggacccctaactaatttaaatacaaaacagccccctatg |
24542840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 279 - 324
Target Start/End: Complemental strand, 29432319 - 29432274
Alignment:
| Q |
279 |
cggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29432319 |
cggttatggacccctaactaatttaaatacaaaacagccccctatg |
29432274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 320
Target Start/End: Original strand, 1377643 - 1377687
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccc |
320 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1377643 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccc |
1377687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 5344546 - 5344498
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
5344546 |
ttgcggttatggacccctaactaatttgaatacaaaacagccccctatg |
5344498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 6386769 - 6386817
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6386769 |
ttgcagttatggacccctaactaatttaaatacaaaacagccccctatg |
6386817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 6769067 - 6769023
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6769067 |
ggttatggacccctaactaatttaaatacaaaacagccccctatg |
6769023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 7119869 - 7119821
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7119869 |
ttgcggttatggactcctaactaatttaaatacaaaacagccccctatg |
7119821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 10045993 - 10046041
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
10045993 |
ttgcggttatggccccctaactaatttaaatacaaaacagccccctatg |
10046041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 11159695 - 11159647
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
11159695 |
ttgcggttatggacccctaactaatttaaatacaaaatagccccctatg |
11159647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 12640858 - 12640906
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
12640858 |
ttgcggttatggacctccaactaatttaaatacaaatcagccccctatg |
12640906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 13021254 - 13021206
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
13021254 |
ttgcggttatggccccctaactaatttaaatacaaaacagccccctatg |
13021206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 14578711 - 14578667
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
14578711 |
ggttatggacccctaactaatttaaatacaaaacagccccctatg |
14578667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 17554321 - 17554273
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
17554321 |
ttgcgattatggacccctaactaatttaaatacaaaacagccccctatg |
17554273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 18988217 - 18988265
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
18988217 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccctatg |
18988265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 21536918 - 21536966
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
21536918 |
ttgcggttatggaaccctaactaatttaaatacaaaacagccccctatg |
21536966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 22160103 - 22160055
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
22160103 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccctatg |
22160055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 24415349 - 24415301
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
24415349 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccttatg |
24415301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 26675331 - 26675283
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
26675331 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccctatg |
26675283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 27247134 - 27247086
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
27247134 |
ttgcggttatggatccctaactaatttaaatacaaaacagccccctatg |
27247086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 27751439 - 27751391
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
27751439 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccctatg |
27751391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 28981951 - 28981999
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
28981951 |
ttgcggttatggatccctaactaatttaaatacaaaacagccccctatg |
28981999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 28982187 - 28982139
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
28982187 |
ttgcggttatggacccctaactaatttaaatacaaaacagtcccctatg |
28982139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 29548218 - 29548266
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29548218 |
ttgcggttatagacccctaactaatttaaatacaaaacagccccctatg |
29548266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 29627882 - 29627834
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
29627882 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccgtatg |
29627834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 30998221 - 30998269
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
30998221 |
ttgcggttatggacccctaactaatttaaatacaaaacagcctcctatg |
30998269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 34363093 - 34363045
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
34363093 |
ttgcggttatgggcccctaactaatttaaatacaaaacagccccctatg |
34363045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 35083622 - 35083666
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35083622 |
ggttatggacccctaactaatttaaatacaaaacagccccctatg |
35083666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 35083856 - 35083808
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35083856 |
ttgcgattatggacccctaactaatttaaatacaaaacagccccctatg |
35083808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 35364470 - 35364422
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
35364470 |
ttgcggttatggacccctaactaatttaaatacaaaacagtcccctatg |
35364422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 39136336 - 39136384
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39136336 |
ttgcggttatggacccataactaatttaaatacaaaacagccccctatg |
39136384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 39946118 - 39946166
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
39946118 |
ttgcggttatggacccccaactaatttaaatacaaaacagccccctatg |
39946166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 40350874 - 40350922
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
40350874 |
ttgcggttatggacccctaactaatttaaatacaaaacagtcccctatg |
40350922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 40351112 - 40351064
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40351112 |
ttgcggttatagacccctaactaatttaaatacaaaacagccccctatg |
40351064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 41205536 - 41205584
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
41205536 |
ttgcggttatggacccctaactaatttaaatacaaaaaagccccctatg |
41205584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 45289538 - 45289586
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
45289538 |
ttgcggttatggacccctaattaatttaaatacaaaacagccccctatg |
45289586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 46282798 - 46282846
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
46282798 |
ttgcggttatggccccctaactaatttaaatacaaaacagccccctatg |
46282846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 46283016 - 46282968
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
46283016 |
ttgcggttatggccccctaactaatttaaatacaaaacagccccctatg |
46282968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 47854014 - 47854062
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
47854014 |
ttgcggttatggacacctaactaatttaaatacaaaacagccccctatg |
47854062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 320
Target Start/End: Complemental strand, 47854255 - 47854211
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccc |
320 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
47854255 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccc |
47854211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 51696574 - 51696622
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
51696574 |
ttgcggttatggactcctaactaatttaaatacaaaacagccccctatg |
51696622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 52045987 - 52045943
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
52045987 |
ggttatggacccctaactaatttaaatacaaaacagccccctatg |
52045943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 52310839 - 52310887
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
52310839 |
ttgcggttatggacccctaactaatttaaatacaaaacggccccctatg |
52310887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 54216232 - 54216184
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
54216232 |
ttgcggttatggacccctaactaatttaaatacaaaacagtcccctatg |
54216184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 54556890 - 54556842
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
54556890 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccctatg |
54556842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 55586892 - 55586844
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
55586892 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccttatg |
55586844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 276 - 319
Target Start/End: Complemental strand, 232966 - 232923
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccc |
319 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
232966 |
ttgcggttatggacccctaactaatttaaatacaaaacagcccc |
232923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 281 - 324
Target Start/End: Original strand, 4107548 - 4107591
Alignment:
| Q |
281 |
gttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4107548 |
gttatggacccctaactaatttaaatacaaaacagccccctatg |
4107591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 276 - 323
Target Start/End: Complemental strand, 11530035 - 11529988
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
11530035 |
ttgcggttatggacccctaactagtttaaatacaaaacagccccctat |
11529988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 276 - 319
Target Start/End: Complemental strand, 41205771 - 41205728
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccc |
319 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41205771 |
ttgcggttatggacccctaactaatttaaatacaaaacagcccc |
41205728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 276 - 323
Target Start/End: Complemental strand, 44921885 - 44921838
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
44921885 |
ttgcggttatggatccctaactaatttaaatacaaaacagccccctat |
44921838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 278 - 324
Target Start/End: Complemental strand, 39136570 - 39136524
Alignment:
| Q |
278 |
gcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39136570 |
gcggttatggacccttaactaatttaaatacaaaacagccccctatg |
39136524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 280 - 321
Target Start/End: Complemental strand, 7666469 - 7666428
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccct |
321 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7666469 |
ggttatggacccctaactaatttaaatacaaaacagccccct |
7666428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 267 - 324
Target Start/End: Original strand, 17221331 - 17221388
Alignment:
| Q |
267 |
taggcttaattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| || || ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
17221331 |
taggcttaattgcacttttgaacccctaactaatttaaatacaaaacagccccctatg |
17221388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 279 - 324
Target Start/End: Original strand, 35835817 - 35835862
Alignment:
| Q |
279 |
cggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
35835817 |
cggttatggacccctaactaatttaaatacaaaacaaccccctatg |
35835862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 1377862 - 1377814
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
1377862 |
ttgcggttatgaccccctaactaatttaaatacaaaacagccccctatg |
1377814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 4902174 - 4902222
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| ||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
4902174 |
ttgctgttatggccccctaactaatttaaatacaaaacagccccctatg |
4902222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 4902431 - 4902383
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||| ||||| |
|
|
| T |
4902431 |
ttgcggttatggccccctaactaatttaaatacaaaacagccctctatg |
4902383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 5344308 - 5344356
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5344308 |
ttgcggttatagacccttaactaatttaaatacaaaacagccccctatg |
5344356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 7666238 - 7666286
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
7666238 |
ttgcggttatgaacccctaaccaatttaaatacaaaacagccccctatg |
7666286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 7705628 - 7705676
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
7705628 |
ttgcggttatggacccttaactaatttaaatacaaaatagccccctatg |
7705676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 8482897 - 8482945
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||||||| |||| |
|
|
| T |
8482897 |
ttgcggttatggaccccaaactaatttaaatacaaaacagccccatatg |
8482945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 8483135 - 8483087
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
8483135 |
ttgcggttatagacccctaactaatttaaatacaaatcagccccctatg |
8483087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 8891924 - 8891880
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
8891924 |
ggttatggacccctaactaatttaaatacaaaacagcctcctatg |
8891880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 10046211 - 10046163
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
10046211 |
ttgcggttatggccccttaactaatttaaatacaaaacagccccctatg |
10046163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 11529797 - 11529845
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||| ||||| |
|
|
| T |
11529797 |
ttgcggttatggaccccttactaatttaaatacaaaacagccctctatg |
11529845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 17265887 - 17265935
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
17265887 |
ttgcggttatggattcctaactaatttaaatacaaaacagccccctatg |
17265935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 18988455 - 18988407
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||| |||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
18988455 |
ttgcggctatggacccctaactaatttaaatataaaacagccccctatg |
18988407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 320
Target Start/End: Original strand, 18994859 - 18994903
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccc |
320 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
18994859 |
ttgcggttatggccccctaactaatttaaatacaaaacagccccc |
18994903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 22159867 - 22159915
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||| |||||||| |
|
|
| T |
22159867 |
ttgcggttatggatccctaactaatttaaatacaaaacagtcccctatg |
22159915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 23770042 - 23769994
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
23770042 |
ttgcggttatggccccataactaatttaaatacaaaacagccccctatg |
23769994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 24415111 - 24415159
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| |||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
24415111 |
ttgcagttatggatccctaactaatttaaatacaaaacagccccctatg |
24415159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 26171279 - 26171327
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
26171279 |
ttgcagttatggacccctaactaatttaaatacaaaacagccccttatg |
26171327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 27751205 - 27751249
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
27751205 |
ggttatggacccctaactaatttaaatacaaaacagccccttatg |
27751249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 28158934 - 28158982
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||| ||||||||| |
|
|
| T |
28158934 |
ttgcggttatggatccctaactaatttaaatacaaaacaaccccctatg |
28158982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 29548451 - 29548407
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
29548451 |
ggttatggacccctaactaatttaaatacaaaacagtcccctatg |
29548407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 30998459 - 30998411
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | |||||||||||||||||| |||||||||||||| |
|
|
| T |
30998459 |
ttgcggttatggatccctaactaatttaaatacataacagccccctatg |
30998411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 33338087 - 33338135
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
33338087 |
ttgcggttatgaccccctaactaatttaaatacaaaacagccccctatg |
33338135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 33338305 - 33338257
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||| ||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
33338305 |
ttgcggttctggccccctaactaatttaaatacaaaacagccccctatg |
33338257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 34362858 - 34362906
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| || |||||||| |
|
|
| T |
34362858 |
ttgcggttatggacccctaactaatttaaatacaaaagagtcccctatg |
34362906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 34957632 - 34957584
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||| |||| |
|
|
| T |
34957632 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccttatg |
34957584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 37973551 - 37973599
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
37973551 |
ttgcggttatagacccctaactaatttaaatacaaaacagccccatatg |
37973599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 38371313 - 38371357
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
38371313 |
ggttatggacccctaactaatttaaatacaaaacatccccctatg |
38371357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 39332357 - 39332405
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||| |||||||| |
|
|
| T |
39332357 |
ttgcggttatggccccctaactaatttaaatacaaaacagtcccctatg |
39332405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 39946348 - 39946304
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
39946348 |
ggttatggacccctaactaatttaaatataaaacagccccctatg |
39946304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 268 - 324
Target Start/End: Complemental strand, 41707999 - 41707943
Alignment:
| Q |
268 |
aggcttaattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || |||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
41707999 |
aggcttaattgcacttttggatccctaactaatttaaatacaaaacagccccctatg |
41707943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 41788339 - 41788291
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
41788339 |
ttgcggttatggccctctaactaatttaaatacaaaacattcccctatg |
41788291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 42672106 - 42672154
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| || | ||||||||||||||||||||||||||||||||| |
|
|
| T |
42672106 |
ttgcggttatagatccctaactaatttaaatacaaaacagccccctatg |
42672154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 44921652 - 44921700
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||| ||||||||| |
|
|
| T |
44921652 |
ttgcggttatggatccctaactaatttaaatacaaaacaaccccctatg |
44921700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 47821598 - 47821550
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
47821598 |
ttgcggttatgaccccctaactaatttaaatacaaaacagccccctatg |
47821550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 52311077 - 52311029
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
52311077 |
ttgcggttatggacccctaactaatttaaatacaaaacaaacccctatg |
52311029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 56296873 - 56296825
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||| ||||||||||||||||||||| |
|
|
| T |
56296873 |
ttgcggttatggtcccctaactaattttaatacaaaacagccccctatg |
56296825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 285 - 324
Target Start/End: Original strand, 11159459 - 11159498
Alignment:
| Q |
285 |
tggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11159459 |
tggacccctaactaatttaaatacaaaacagccccctatg |
11159498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 285 - 324
Target Start/End: Complemental strand, 21537143 - 21537104
Alignment:
| Q |
285 |
tggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
21537143 |
tggacccctaactaatttaaatacaaaacagccccctatg |
21537104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 281 - 324
Target Start/End: Original strand, 23315425 - 23315468
Alignment:
| Q |
281 |
gttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
23315425 |
gttatggacccctaactaatttaaatacaaaacagtcccctatg |
23315468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 276 - 323
Target Start/End: Complemental strand, 37432493 - 37432446
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
|||||||||| || | |||||||||||||||||||||||||||||||| |
|
|
| T |
37432493 |
ttgcggttattgatccctaactaatttaaatacaaaacagccccctat |
37432446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 276 - 323
Target Start/End: Original strand, 56296655 - 56296702
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
56296655 |
ttgcggttatgtccccctaactaatttaaatacaaaacagccccctat |
56296702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 276 - 318
Target Start/End: Original strand, 14578476 - 14578518
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccc |
318 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
14578476 |
ttgcggttatgtacccctaactaatttaaatacaaaacagccc |
14578518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 268 - 324
Target Start/End: Original strand, 232724 - 232780
Alignment:
| Q |
268 |
aggcttaattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || |||||| |||||||||||||||| ||||||| |||||||| |
|
|
| T |
232724 |
aggcttaattgcacttttggacccctaactaatttaaatataaaacagtcccctatg |
232780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 3770217 - 3770265
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| |||||| || |||||||||||||||||||||||| |||||||| |
|
|
| T |
3770217 |
ttgcgattatggccccctaactaatttaaatacaaaacagacccctatg |
3770265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 3770435 - 3770387
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||| |||||||| |
|
|
| T |
3770435 |
ttgcggttatgaccccctaactaatttaaatacaaaacagacccctatg |
3770387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 6033888 - 6033840
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| || ||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6033888 |
ttgcgattttggccctctaactaattaaaatacaaaacagccccctatg |
6033840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 8143071 - 8143119
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| || |||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
8143071 |
ttgcgattttggacccctaactaattaaaatacaaaacagccccctatg |
8143119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 12641094 - 12641046
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| | ||||||| |
|
|
| T |
12641094 |
ttgcggttatggacccttaactaatttaaatacaaaacaacgccctatg |
12641046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 14816883 - 14816835
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| || |||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
14816883 |
ttgcgattttggacccctaactaattaaaatacaaaacagccccctatg |
14816835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 17266022 - 17265974
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
17266022 |
ttgcggttatttacccctaactaatttaaatacaaaacagctccctatg |
17265974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 320
Target Start/End: Original strand, 18994705 - 18994749
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccc |
320 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
18994705 |
ttgcggttatgaccccctaactaatttaaatacaaaacagccccc |
18994749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 320
Target Start/End: Complemental strand, 18995078 - 18995034
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccc |
320 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
18995078 |
ttgcggttatgaccccctaactaatttaaatacaaaacagccccc |
18995034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 19693059 - 19693103
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
19693059 |
ggttacggacccctaactaatttaaatacaaaacagacccctatg |
19693103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 19703644 - 19703688
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
19703644 |
ggttacggacccctaactaatttaaatacaaaacagacccctatg |
19703688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 20473765 - 20473797
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
20473765 |
ctaactaatttaaatacaaaacagccccctatg |
20473797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 28159303 - 28159255
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||| ||| ||||| |
|
|
| T |
28159303 |
ttgcggttaaggacccctaactaatttaaatacaaaacaaccctctatg |
28159255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 31843829 - 31843873
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
31843829 |
ggttatggactcctaactaatttaaatacaaaacagacccctatg |
31843873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 37973790 - 37973742
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||| |||||||||||||||| |||||| ||||||||| |
|
|
| T |
37973790 |
ttgcggttatgaacccctaactaatttaaatataaaacaaccccctatg |
37973742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 39332573 - 39332526
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||| ||||||||| |
|
|
| T |
39332573 |
ttgcggttatggccc-ctaactaatttaaatacaaaacaaccccctatg |
39332526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 43821957 - 43821925
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
43821957 |
ctaactaatttaaatacaaaacagccccctatg |
43821925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 50073571 - 50073523
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| || ||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
50073571 |
ttgcgattttggtcctctaactaattaaaatacaaaacagccccctatg |
50073523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 50513317 - 50513269
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||| || ||||| |
|
|
| T |
50513317 |
ttgcggttatggacccctaattaatttaaatacaaaacagtcctctatg |
50513269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 51537706 - 51537659
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||| ||||| |
|
|
| T |
51537706 |
ttgcggttatggacc-ctaactaatttaaatacaaaacatccctctatg |
51537659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 51537891 - 51537843
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||| || ||||| |
|
|
| T |
51537891 |
ttgcggttatgaacccctaactaatttaaatacaaaacagtcctctatg |
51537843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 54606925 - 54606973
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
54606925 |
ttgcggttatagactcctaactaatttaaatacaaaatagccccctatg |
54606973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 280 - 319
Target Start/End: Original strand, 13019315 - 13019354
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagcccc |
319 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
13019315 |
ggttatggcccactaactaatttaaatacaaaacagcccc |
13019354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 276 - 323
Target Start/End: Original strand, 13607955 - 13608002
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||| ||| |||| |
|
|
| T |
13607955 |
ttgcggttatggacccctaactaatttaaatataaaacaaccctctat |
13608002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 276 - 319
Target Start/End: Complemental strand, 24543018 - 24542975
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccc |
319 |
Q |
| |
|
|||| |||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
24543018 |
ttgcagttatggatccctaactaatttaaatacaaaacagcccc |
24542975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 276 - 323
Target Start/End: Original strand, 36413717 - 36413764
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
||||| || ||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36413717 |
ttgcgattttggccctctaactaattaaaatacaaaacagccccctat |
36413764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 276 - 314
Target Start/End: Original strand, 47821513 - 47821551
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaaca |
314 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
47821513 |
ttgcggttatggccccctaactaatttaaatacaaaaca |
47821551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 279 - 324
Target Start/End: Complemental strand, 26171512 - 26171467
Alignment:
| Q |
279 |
cggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| | |||| ||||||||||| |||||||||||||||| |
|
|
| T |
26171512 |
cggttatggatccctaattaatttaaatataaaacagccccctatg |
26171467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 274 - 319
Target Start/End: Original strand, 29432083 - 29432128
Alignment:
| Q |
274 |
aattgcggttatggacctctaactaatttaaatacaaaacagcccc |
319 |
Q |
| |
|
|||||||||| || ||| ||||||||||||||||||||| |||||| |
|
|
| T |
29432083 |
aattgcggttgtgaacccctaactaatttaaatacaaaatagcccc |
29432128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 279 - 324
Target Start/End: Original strand, 38153685 - 38153730
Alignment:
| Q |
279 |
cggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||| | |||||| |
|
|
| T |
38153685 |
cggttatggtcccctaactaatttaaatacaaaacagactcctatg |
38153730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 274 - 315
Target Start/End: Original strand, 39668908 - 39668949
Alignment:
| Q |
274 |
aattgcggttatggacctctaactaatttaaatacaaaacag |
315 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||| ||||||| |
|
|
| T |
39668908 |
aattgcggttatgaacccctaactaatttaaatataaaacag |
39668949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 292 - 325
Target Start/End: Original strand, 47629427 - 47629460
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatgc |
325 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
47629427 |
ctaactaattaaaatacaaaacagccccctatgc |
47629460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 279 - 316
Target Start/End: Complemental strand, 51544479 - 51544442
Alignment:
| Q |
279 |
cggttatggacctctaactaatttaaatacaaaacagc |
316 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
51544479 |
cggttttggacctctaactaattaaaatacaaaacagc |
51544442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 320
Target Start/End: Complemental strand, 4107779 - 4107735
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccc |
320 |
Q |
| |
|
||||||||||||| | |||||||||||||||| ||||||| |||| |
|
|
| T |
4107779 |
ttgcggttatggatccctaactaatttaaatataaaacagtcccc |
4107735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 320
Target Start/End: Original strand, 7396194 - 7396222
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccc |
320 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
7396194 |
ctaactaatttaaatacaaaacagccccc |
7396222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #177
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 9119439 - 9119487
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| || ||| ||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
9119439 |
ttgcgattttggccctctaactaattaaaatacaaaacaaccccctatg |
9119487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #178
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 12892878 - 12892910
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
12892878 |
ctaactaattaaaatacaaaacagccccctatg |
12892910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #179
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 316
Target Start/End: Complemental strand, 13608196 - 13608156
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagc |
316 |
Q |
| |
|
||||||||||||| | |||||||||||||||| |||||||| |
|
|
| T |
13608196 |
ttgcggttatggaaccctaactaatttaaatataaaacagc |
13608156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #180
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 315
Target Start/End: Complemental strand, 17221577 - 17221537
Alignment:
| Q |
276 |
ttgcggttatggacctc-taactaatttaaatacaaaacag |
315 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
17221577 |
ttgcggttatggaccccctaactaatttaaatacaaaacag |
17221537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #181
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 22589451 - 22589419
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
22589451 |
ctaactaattaaaatacaaaacagccccctatg |
22589419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #182
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 23777339 - 23777291
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| || ||| ||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
23777339 |
ttgcgattttggccctctaactaattaaaatacaaaacagccccttatg |
23777291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #183
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 28291929 - 28291881
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| || ||| ||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
28291929 |
ttgcgattttggtcctctaactaattaaaatacaaaatagccccctatg |
28291881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #184
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 31250516 - 31250564
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| || ||||| |
|
|
| T |
31250516 |
ttgcggttatggattcctaactaatttaaatacaaaacagacctctatg |
31250564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #185
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 319
Target Start/End: Original strand, 31560079 - 31560122
Alignment:
| Q |
276 |
ttgcggttatggacct-ctaactaatttaaatacaaaacagcccc |
319 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
31560079 |
ttgcggttat-gacctcctaactaatttaaatacaaaacagcccc |
31560122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #186
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 31760880 - 31760912
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
31760880 |
ctaactaattaaaatacaaaacagccccctatg |
31760912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #187
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 33166314 - 33166362
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| || ||||||| ||||||||| |||||||||||| ||||||||| |
|
|
| T |
33166314 |
ttgcgattttggacctttaactaattaaaatacaaaacaaccccctatg |
33166362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #188
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 36945567 - 36945599
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
36945567 |
ctaactaattaaaatacaaaacagccccctatg |
36945599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #189
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 43821757 - 43821804
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||| ||||||||| |
|
|
| T |
43821757 |
ttgcggttatggccca-taactaatttaaatacaaaacaaccccctatg |
43821804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #190
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 44271938 - 44271906
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
44271938 |
ctaactaattaaaatacaaaacagccccctatg |
44271906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #191
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 48277958 - 48278002
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| | |||||||||||||| | |||||||||||||| |
|
|
| T |
48277958 |
ggttatggaccccaaactaatttaaatatataacagccccctatg |
48278002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #192
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 50513083 - 50513131
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| |||||||| | ||||||||||||||||||||||| |||| |||| |
|
|
| T |
50513083 |
ttgcagttatggatccctaactaatttaaatacaaaacaaccccttatg |
50513131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #193
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 51543044 - 51543076
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
51543044 |
ctaactaattaaaatacaaaacagccccctatg |
51543076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #194
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 54607153 - 54607105
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||| ||||| ||||| |
|
|
| T |
54607153 |
ttgcggttatgaacccttaactaatttaaatacaaaatagccctctatg |
54607105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #195
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 55732622 - 55732654
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
55732622 |
ctaactaattaaaatacaaaacagccccctatg |
55732654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 49; Significance: 5e-19; HSPs: 213)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 5154056 - 5154008
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5154056 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
5154008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 276 - 322
Target Start/End: Complemental strand, 27984407 - 27984361
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccccta |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27984407 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccccta |
27984361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 787137 - 787185
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
787137 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
787185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 2118751 - 2118799
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2118751 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
2118799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 2239265 - 2239313
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2239265 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
2239313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 2239505 - 2239457
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2239505 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
2239457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 19391978 - 19391930
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
19391978 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
19391930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 22202522 - 22202570
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
22202522 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
22202570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 25126273 - 25126225
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
25126273 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
25126225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 27748518 - 27748470
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
27748518 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
27748470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 27766556 - 27766604
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
27766556 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
27766604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 27766792 - 27766744
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
27766792 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
27766744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 28097455 - 28097503
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28097455 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
28097503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 28097699 - 28097651
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28097699 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
28097651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 31117658 - 31117706
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
31117658 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
31117706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 31577691 - 31577647
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31577691 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
31577647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 31869233 - 31869281
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
31869233 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
31869281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 32205122 - 32205074
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32205122 |
ttgcggttatggacctctaactaatttaaatacaaatcagccccctatg |
32205074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 32508194 - 32508146
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32508194 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
32508146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 33252760 - 33252712
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33252760 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
33252712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 33576445 - 33576493
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33576445 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
33576493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 33621904 - 33621952
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33621904 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
33621952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 41282122 - 41282074
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41282122 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
41282074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 42230306 - 42230258
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42230306 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
42230258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 44177326 - 44177374
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
44177326 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
44177374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 45744174 - 45744126
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
45744174 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
45744126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 45760270 - 45760318
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
45760270 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
45760318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 45760508 - 45760460
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
45760508 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
45760460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 50033516 - 50033468
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
50033516 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
50033468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 276 - 323
Target Start/End: Original strand, 45743937 - 45743984
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45743937 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctat |
45743984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 276 - 323
Target Start/End: Original strand, 47943497 - 47943544
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
47943497 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctat |
47943544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 276 - 323
Target Start/End: Complemental strand, 47943735 - 47943688
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
47943735 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctat |
47943688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 274 - 324
Target Start/End: Original strand, 31577455 - 31577505
Alignment:
| Q |
274 |
aattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
31577455 |
aattgcggttatggacccctaactaatttaaatacaaaacaaccccctatg |
31577505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 279 - 324
Target Start/End: Complemental strand, 9153749 - 9153704
Alignment:
| Q |
279 |
cggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9153749 |
cggttatggacccctaactaatttaaatacaaaacagccccctatg |
9153704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 267 - 324
Target Start/End: Original strand, 17916110 - 17916167
Alignment:
| Q |
267 |
taggcttaattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| || |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
17916110 |
taggcttaattgcacttttggacccctaactaatttaaatacaaaacagccccctatg |
17916167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 276 - 321
Target Start/End: Complemental strand, 29169003 - 29168958
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccct |
321 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29169003 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccct |
29168958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 257476 - 257524
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
257476 |
ttgcggttatgaacccctaactaatttaaatacaaaacagccccctatg |
257524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 3212427 - 3212379
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
3212427 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccctatg |
3212379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 8727951 - 8727999
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
8727951 |
ttgcggttatggacccctaactaatttaaatacaaaacagtcccctatg |
8727999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 9079838 - 9079886
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
9079838 |
ttgcggttatggacccctaactaatttaaatacaaaacagtcccctatg |
9079886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 9630806 - 9630854
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9630806 |
ttgcggttatgaacccctaactaatttaaatacaaaacagccccctatg |
9630854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 10864153 - 10864201
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
10864153 |
ttgcggttatggacccctaactaatttaaatacaaaacagccctctatg |
10864201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 12881273 - 12881321
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
12881273 |
ttgcggttatggccccctaactaatttaaatacaaaacagccccctatg |
12881321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 12881490 - 12881442
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
12881490 |
ttgcggttatggccccctaactaatttaaatacaaaacagccccctatg |
12881442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 14133678 - 14133726
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
14133678 |
ttgcggttatggccccctaactaatttaaatacaaaacagccccctatg |
14133726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 17483603 - 17483647
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
17483603 |
ggttatggacccctaactaatttaaatacaaaacagccccctatg |
17483647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 17483833 - 17483785
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
17483833 |
ttgcggttatggatccctaactaatttaaatacaaaacagccccctatg |
17483785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 19391676 - 19391724
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
19391676 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccatatg |
19391724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 19914514 - 19914562
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
19914514 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccttatg |
19914562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 19914747 - 19914699
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
19914747 |
ttgcggttatggacccctaactaatttaaatacaaaatagccccctatg |
19914699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 27857410 - 27857362
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
27857410 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccttatg |
27857362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 28964191 - 28964239
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
28964191 |
ttgcggttatggacccctaactaatttaaatacaaaacagcctcctatg |
28964239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 28964425 - 28964381
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28964425 |
ggttatggacccctaactaatttaaatacaaaacagccccctatg |
28964381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 30200689 - 30200641
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
30200689 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccctatg |
30200641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 320
Target Start/End: Complemental strand, 30761075 - 30761031
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccc |
320 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30761075 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccc |
30761031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 32204886 - 32204934
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32204886 |
ttgcgcttatggacccctaactaatttaaatacaaaacagccccctatg |
32204934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 32458817 - 32458865
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32458817 |
ttgcggttatagacccctaactaatttaaatacaaaacagccccctatg |
32458865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 32459058 - 32459010
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
32459058 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccatatg |
32459010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 33576684 - 33576636
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
33576684 |
ttgcggttatggacccctaactaatttaaatacaaaacagcctcctatg |
33576636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 33622141 - 33622093
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
33622141 |
ttgcggttatggacccctaactaatttaaatacaaaacagccctctatg |
33622093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 33933643 - 33933595
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33933643 |
ttgcggttatagacccctaactaatttaaatacaaaacagccccctatg |
33933595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 36017036 - 36016988
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36017036 |
ttgcggttatgcacccctaactaatttaaatacaaaacagccccctatg |
36016988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 36373820 - 36373772
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36373820 |
ttgcggttatggacccttaactaatttaaatacaaaacagccccctatg |
36373772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 37182274 - 37182226
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
37182274 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccctatg |
37182226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 38511697 - 38511745
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38511697 |
ttgcggttatggacccttaactaatttaaatacaaaacagccccctatg |
38511745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 38511932 - 38511884
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38511932 |
ttgcggttatagacccctaactaatttaaatacaaaacagccccctatg |
38511884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 41281887 - 41281931
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41281887 |
ggttatggacccctaactaatttaaatacaaaacagccccctatg |
41281931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 42230071 - 42230119
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
42230071 |
ttgcggttatggatccctaactaatttaaatacaaaacagccccctatg |
42230119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 44184010 - 44184058
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
44184010 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccatatg |
44184058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 44895923 - 44895875
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
44895923 |
ttgcggttatggacccctaactaatttaaatacaaaacagtcccctatg |
44895875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 47423185 - 47423233
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
47423185 |
ttgcggttatggccccctaactaatttaaatacaaaacagccccctatg |
47423233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 47530615 - 47530567
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
47530615 |
ttgcggttatggacccctaactaatttaaatacaaaacggccccctatg |
47530567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 49997931 - 49997883
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
49997931 |
ttgcggttatggacccctaactaatttaaatacaaatcagccccctatg |
49997883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 51842839 - 51842887
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
51842839 |
ttgcggttatggacccctaactaatttaaatacaaaacagtcccctatg |
51842887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 51860371 - 51860419
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
51860371 |
ttgcggttatggacccataactaatttaaatacaaaacagccccctatg |
51860419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 51860603 - 51860555
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
51860603 |
ttgcggttatggacccctaattaatttaaatacaaaacagccccctatg |
51860555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 52916897 - 52916945
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
52916897 |
ttgcggttatggacccctaactaatttaaatacaaaacagacccctatg |
52916945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 52917594 - 52917546
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
52917594 |
ttgcggttatggatccctaactaatttaaatacaaaacagccccctatg |
52917546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 53191238 - 53191190
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
53191238 |
ttgcggttatggatccctaactaatttaaatacaaaacagccccctatg |
53191190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 53192152 - 53192200
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
53192152 |
ttgcggttatggacccctatctaatttaaatacaaaacagccccctatg |
53192200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 53192388 - 53192340
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
53192388 |
ttgcggttatggacctctaactaatttaaattcaaaacaaccccctatg |
53192340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 53422127 - 53422175
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
53422127 |
ttgcggttatggacccctaactaatttaaatacaaaacagccacctatg |
53422175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 53531844 - 53531892
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
53531844 |
ttgcggttaaggacccctaactaatttaaatacaaaacagccccctatg |
53531892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 53532081 - 53532033
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
53532081 |
ttgcggttatggacccctaactaatttaaatacaaaaccgccccctatg |
53532033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 276 - 319
Target Start/End: Complemental strand, 3384263 - 3384220
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccc |
319 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3384263 |
ttgcggttatggacctctaattaatttaaatacaaaacagcccc |
3384220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 276 - 319
Target Start/End: Original strand, 29168767 - 29168810
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccc |
319 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
29168767 |
ttgcggttatggacccctaactaatttaaatacaaaacagcccc |
29168810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 276 - 323
Target Start/End: Original strand, 47722187 - 47722234
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
47722187 |
ttgcggttatggatccctaactaatttaaatacaaaacagccccctat |
47722234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 276 - 318
Target Start/End: Complemental strand, 787375 - 787333
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccc |
318 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
787375 |
ttgcggttatggacccctaactaatttaaatacaaaacagccc |
787333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 274 - 324
Target Start/End: Complemental strand, 2205805 - 2205755
Alignment:
| Q |
274 |
aattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2205805 |
aattgcggttatagactcctaactaatttaaatacaaaacagccccctatg |
2205755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 282 - 324
Target Start/End: Complemental strand, 9588383 - 9588341
Alignment:
| Q |
282 |
ttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9588383 |
ttatggacccctaactaatttaaatacaaaacagccccctatg |
9588341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 274 - 324
Target Start/End: Complemental strand, 9793196 - 9793146
Alignment:
| Q |
274 |
aattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
9793196 |
aattgcggttatggacccataactaatttaaatacaaaacagccccttatg |
9793146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 274 - 324
Target Start/End: Complemental strand, 31117896 - 31117846
Alignment:
| Q |
274 |
aattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
31117896 |
aattgtggttatggacccctaactaatttaaatacaaaacagcctcctatg |
31117846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 276 - 322
Target Start/End: Original strand, 41722092 - 41722138
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccccta |
322 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
41722092 |
ttgcggttatggacccctaactaatttaaatacaaaacagctcccta |
41722138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 276 - 318
Target Start/End: Complemental strand, 47360501 - 47360459
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccc |
318 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
47360501 |
ttgcggttatggacccctaactaatttaaatacaaaacagccc |
47360459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 279 - 324
Target Start/End: Complemental strand, 21690141 - 21690096
Alignment:
| Q |
279 |
cggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
21690141 |
cggttatgggcccctaactaatttaaatacaaaacagccccctatg |
21690096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 279 - 324
Target Start/End: Complemental strand, 44624498 - 44624453
Alignment:
| Q |
279 |
cggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
44624498 |
cggttatggacccctaactaatttaaatacaaaatagccccctatg |
44624453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 257707 - 257663
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
257707 |
ggttatggacccctaactaatttaaatacaaaacaaccccctatg |
257663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 2118989 - 2118941
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
2118989 |
ttgcggttatggactcctaactaatttaaatacaaaacagccccttatg |
2118941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 3212191 - 3212239
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
3212191 |
ttgcggttatgaacccctaactaatttaaatacaaaacagccccttatg |
3212239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 279 - 319
Target Start/End: Original strand, 5153822 - 5153862
Alignment:
| Q |
279 |
cggttatggacctctaactaatttaaatacaaaacagcccc |
319 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5153822 |
cggttatggacccctaactaatttaaatacaaaacagcccc |
5153862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 5576971 - 5577019
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
5576971 |
ttgcggttatgcacccctaactaatttaaatacaaaacaaccccctatg |
5577019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 7858237 - 7858189
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||| |||||||| |
|
|
| T |
7858237 |
ttgcggttatggccccctaactaatttaaatacaaaacagtcccctatg |
7858189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 10439328 - 10439372
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
10439328 |
ggttatggacccctaactaatttaaatacaaaacagccccatatg |
10439372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 10439555 - 10439507
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| || |||||| |
|
|
| T |
10439555 |
ttgcggttatggacccctaactaatttaaatacaaaacaacctcctatg |
10439507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 11961903 - 11961951
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
11961903 |
ttgcggttacggacccctaactaatttaaatacaaaacagacccctatg |
11961951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 11963000 - 11962952
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
11963000 |
ttgcggttacggacccctaactaatttaaatacaaaacagacccctatg |
11962952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 17916358 - 17916310
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||| ||||||||| |
|
|
| T |
17916358 |
ttgcggttatggacccctaactaagttaaatacaaaacatccccctatg |
17916310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 20982318 - 20982366
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||| ||||| |
|
|
| T |
20982318 |
ttgcggttatggccccctaactaatttaaatacaaaacagccctctatg |
20982366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 20982534 - 20982487
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
20982534 |
ttgcggttatggccc-ctaactaatttaaatacaaaacagccccctatg |
20982487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 24393963 - 24393919
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
24393963 |
ggttatggacccttaactaatttaaatacaaaacagccccctatg |
24393919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 25053859 - 25053811
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
25053859 |
ttgcggttatggccccttaactaatttaaatacaaaacagccccctatg |
25053811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 25782691 - 25782739
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
25782691 |
ttgcggttatgaacccctaactaatttaaatacaaaacaaccccctatg |
25782739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 25782928 - 25782880
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| | ||||||| |
|
|
| T |
25782928 |
ttgcggttatggacccctaactaatttaaatacaaaacaactccctatg |
25782880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 26012943 - 26012896
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
26012943 |
ttgcggttatggccc-ctaactaatttaaatacaaaacagccccctatg |
26012896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 27448852 - 27448900
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||| |||| |
|
|
| T |
27448852 |
ttgcggttatggtcccctaactaatttaaatacaaaacagccccttatg |
27448900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 27748282 - 27748330
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | |||| |||||||||||||||||||||||||||| |
|
|
| T |
27748282 |
ttgcggttatggatccctaattaatttaaatacaaaacagccccctatg |
27748330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 30200454 - 30200502
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||||||| |||| |
|
|
| T |
30200454 |
ttgcggttatggacccctaactaatttaaatataaaacagccccatatg |
30200502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 268 - 324
Target Start/End: Original strand, 33933397 - 33933453
Alignment:
| Q |
268 |
aggcttaattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || |||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
33933397 |
aggcttaattgcacttttggacccctaactaatttaaatacaaaacagccctctatg |
33933453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 36567150 - 36567102
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||| |||||||| |
|
|
| T |
36567150 |
ttgcggttatggccccctaactaatttaaatacaaaacagacccctatg |
36567102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 37182042 - 37182090
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||| ||||||| |
|
|
| T |
37182042 |
ttgcggttatggacccctaactattttaaatacaaaacagctccctatg |
37182090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 39905766 - 39905814
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
39905766 |
ttgcggttatgaccccctaactaatttaaatacaaaacagccccctatg |
39905814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 41223784 - 41223740
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
41223784 |
ggttatggacccctaactaatttaaatacaaaacagccctctatg |
41223740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 44184246 - 44184198
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| | |||||| |
|
|
| T |
44184246 |
ttgcggttatggacccctaactaatttaaatacaaaacagtctcctatg |
44184198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 47530377 - 47530425
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
47530377 |
ttgcggttatggacccctaactaatttaaatacaaaacaaacccctatg |
47530425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 49859726 - 49859678
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
49859726 |
ttgcggttatgatcccctaactaatttaaatacaaaacagccccctatg |
49859678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 49997693 - 49997741
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||| |||| |
|
|
| T |
49997693 |
ttgcggttatggatccctaactaatttaaatacaaaacagccccatatg |
49997741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 51213345 - 51213393
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| ||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
51213345 |
ttgcgattatggaccccaaactaatttaaatacaaaacagccccctatg |
51213393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 51843077 - 51843029
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
51843077 |
ttgcggttatgaacccctaactaatttaaatacaaaacaaccccctatg |
51843029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 53190999 - 53191047
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | |||| |||||||||||||||||||||||||||| |
|
|
| T |
53190999 |
ttgcggttatggaacactaaataatttaaatacaaaacagccccctatg |
53191047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 280 - 323
Target Start/End: Complemental strand, 5577204 - 5577161
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
5577204 |
ggttatggacccctaattaatttaaatacaaaacagccccctat |
5577161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 276 - 315
Target Start/End: Complemental strand, 9633673 - 9633634
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacag |
315 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9633673 |
ttgcggttatggacccctaactaatttaaatacaaaacag |
9633634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 276 - 323
Target Start/End: Complemental strand, 24636616 - 24636569
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
24636616 |
ttgcggttatggacccttaactaatttaaatacaaaacaaccccctat |
24636569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 276 - 323
Target Start/End: Original strand, 25053641 - 25053688
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
|||||||||||| || |||||||||||||||| ||||||||||||||| |
|
|
| T |
25053641 |
ttgcggttatggccccctaactaatttaaatataaaacagccccctat |
25053688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 276 - 323
Target Start/End: Complemental strand, 47722425 - 47722378
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
47722425 |
ttgcggttatggactcataactaatttaaatacaaaacagccccctat |
47722378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 280 - 318
Target Start/End: Original strand, 24393733 - 24393771
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccc |
318 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
24393733 |
ggttatggacccctaactaatttaaatacaaaacagccc |
24393771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 276 - 318
Target Start/End: Original strand, 32507965 - 32508007
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccc |
318 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32507965 |
ttgcggttatggacccttaactaatttaaatacaaaacagccc |
32508007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 274 - 324
Target Start/End: Original strand, 40409839 - 40409889
Alignment:
| Q |
274 |
aattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||| || ||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40409839 |
aattgcgattttggccctctaactaattaaaatacaaaacagccccctatg |
40409889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 276 - 318
Target Start/End: Original strand, 41223551 - 41223593
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccc |
318 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
41223551 |
ttgcggttatagacccctaactaatttaaatacaaaacagccc |
41223593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 280 - 317
Target Start/End: Original strand, 2205579 - 2205616
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagcc |
317 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
2205579 |
ggttatggacccctaactaatttaaatacaaaacagcc |
2205616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 279 - 324
Target Start/End: Complemental strand, 22202755 - 22202710
Alignment:
| Q |
279 |
cggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||||||||| ||||| |
|
|
| T |
22202755 |
cggttatggatccctaactaatttaaatacaaaacagccctctatg |
22202710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 275 - 320
Target Start/End: Original strand, 27719743 - 27719788
Alignment:
| Q |
275 |
attgcggttatggacctctaactaatttaaatacaaaacagccccc |
320 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
27719743 |
attgcggttatgaccccctaactaatttaaatacaaaacagccccc |
27719788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 279 - 324
Target Start/End: Original strand, 36566914 - 36566959
Alignment:
| Q |
279 |
cggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||| |||||||| |
|
|
| T |
36566914 |
cggttatggcccgctaactaatttaaatacaaaacagacccctatg |
36566959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 276 - 321
Target Start/End: Complemental strand, 40082465 - 40082421
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccct |
321 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
40082465 |
ttgcggttatg-acccctaactaatttaaatacaaaacagccccct |
40082421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 7858035 - 7858067
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
7858035 |
ctaactaatttaaatacaaaacagccccctatg |
7858067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 10864394 - 10864346
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| |||||| ||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
10864394 |
ttgcagttatgaacccctaactaatttaaatacaaaacaaccccctatg |
10864346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 14015418 - 14015370
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||||| |||||| |
|
|
| T |
14015418 |
ttgcggttatgtccccctaactaatttaaatacaaaacagcctcctatg |
14015370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 21689968 - 21690016
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||| |||| |||| |
|
|
| T |
21689968 |
ttgcggttatggccccctaactaatttaaatacaaaacaaccccttatg |
21690016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 21841986 - 21841938
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||| |||||||| |
|
|
| T |
21841986 |
ttgcggttatggccccctaactaatttaaatacaaaacatgcccctatg |
21841938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 31869470 - 31869422
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||| |||||| |||||||||||| ||||||||||||||| |||| |
|
|
| T |
31869470 |
ttgcggttttggacccctaactaatttatatacaaaacagccccttatg |
31869422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 41722255 - 41722211
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
41722255 |
ggttatggacccttaactaatttaaatacaaatcagccccctatg |
41722211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 42465729 - 42465777
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||| | ||||||| |
|
|
| T |
42465729 |
ttgcggttatggtcccctaactaatttaaatacaaaacaactccctatg |
42465777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 43678977 - 43678929
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||| ||||||||| |
|
|
| T |
43678977 |
ttgcggttatgaccccctaactaatttaaatacaaaacaaccccctatg |
43678929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 44177556 - 44177512
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||| |||||||| |
|
|
| T |
44177556 |
ggttatggacccctaactaatttaaatataaaacagtcccctatg |
44177512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 44895687 - 44895735
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||| ||||||||| |||| |
|
|
| T |
44895687 |
ttgcgattatggacccctaactaatttaaatacagaacagccccttatg |
44895735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 46984860 - 46984908
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||| ||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
46984860 |
ttgcggttttggacacctaactaattaaaatacaaaacagccccctatg |
46984908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 50764207 - 50764159
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| || ||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
50764207 |
ttgcgattttggacctctgactaattaaaatacaaaacagccccctatg |
50764159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 51336928 - 51336976
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||| ||||||||| |
|
|
| T |
51336928 |
ttgcggttatgaccccctaactaatttaaatacaaaacaaccccctatg |
51336976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 55228082 - 55228034
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| || |||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
55228082 |
ttgcgattttggacccctaactaattaaaatacaaaacagccccctatg |
55228034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 276 - 319
Target Start/End: Complemental strand, 5636683 - 5636640
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccc |
319 |
Q |
| |
|
||||| || ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5636683 |
ttgcgattttggacctctaactaattaaaatacaaaacagcccc |
5636640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 276 - 315
Target Start/End: Complemental strand, 8315356 - 8315317
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacag |
315 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
8315356 |
ttgcggttatagacccctaactaatttaaatacaaaacag |
8315317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 281 - 324
Target Start/End: Complemental strand, 8728181 - 8728138
Alignment:
| Q |
281 |
gttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
8728181 |
gttatagacccctaactaatttaaatacaaaacaaccccctatg |
8728138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 281 - 324
Target Start/End: Complemental strand, 9080068 - 9080025
Alignment:
| Q |
281 |
gttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
9080068 |
gttatagacccctaactaatttaaatacaaaacaaccccctatg |
9080025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 280 - 323
Target Start/End: Original strand, 21841769 - 21841812
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||| |||||||| |
|
|
| T |
21841769 |
ggttatggccccctaactaatttaaatacaaaacaaccccctat |
21841812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 261 - 324
Target Start/End: Original strand, 27857160 - 27857223
Alignment:
| Q |
261 |
aaaaaataggcttaattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||| ||||||||||| || |||| | |||||||||||||||||||||||| |||||||| |
|
|
| T |
27857160 |
aaaaaaaaggcttaattgtacttttggagccctaactaatttaaatacaaaacagtcccctatg |
27857223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 276 - 323
Target Start/End: Original strand, 32593828 - 32593874
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||| |||||||| |
|
|
| T |
32593828 |
ttgcggttatggccc-ctaactaatttaaatacaaaacaaccccctat |
32593874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 276 - 323
Target Start/End: Complemental strand, 51214434 - 51214387
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||| || ||||||| |
|
|
| T |
51214434 |
ttgcggttatggacccctaactaatttagatacaaaagagacccctat |
51214387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 276 - 319
Target Start/End: Complemental strand, 52613597 - 52613554
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccc |
319 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
52613597 |
ttgcggttatggcctcctaactaatttaaatacaaaacagcccc |
52613554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 276 - 315
Target Start/End: Complemental strand, 53422352 - 53422313
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacag |
315 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
53422352 |
ttgcggttatggatccctaactaatttaaatacaaaacag |
53422313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 276 - 314
Target Start/End: Original strand, 33252522 - 33252560
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaaca |
314 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
33252522 |
ttgcgattatggacccctaactaatttaaatacaaaaca |
33252560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 279 - 321
Target Start/End: Original strand, 44624266 - 44624308
Alignment:
| Q |
279 |
cggttatggacctctaactaatttaaatacaaaacagccccct |
321 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||| ||||| |
|
|
| T |
44624266 |
cggttatgaatctctaactaatttaaatacaaaacagtcccct |
44624308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 287 - 324
Target Start/End: Complemental strand, 10732412 - 10732375
Alignment:
| Q |
287 |
gacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
10732412 |
gacccctaactaattaaaatacaaaacagccccctatg |
10732375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 276 - 317
Target Start/End: Original strand, 26494723 - 26494764
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcc |
317 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26494723 |
ttgcggttatggactcttaactaatttaaatacaaaacagcc |
26494764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 283 - 324
Target Start/End: Complemental strand, 27449063 - 27449022
Alignment:
| Q |
283 |
tatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| || ||||||||||||||||||||||| ||||||||| |
|
|
| T |
27449063 |
tatggtcccctaactaatttaaatacaaaacaaccccctatg |
27449022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 287 - 324
Target Start/End: Complemental strand, 30632389 - 30632352
Alignment:
| Q |
287 |
gacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
30632389 |
gacctctaactaattaaaatacaaaacagcctcctatg |
30632352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #175
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 287 - 324
Target Start/End: Original strand, 42996459 - 42996496
Alignment:
| Q |
287 |
gacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
42996459 |
gacccctaactaattaaaatacaaaacagccccctatg |
42996496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #176
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 5635402 - 5635434
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
5635402 |
ctaactaattaaaatacaaaacagccccctatg |
5635434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #177
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 312
Target Start/End: Original strand, 7818971 - 7819007
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaa |
312 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7818971 |
ttgcggttatggactcctaactaatttaaatacaaaa |
7819007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #178
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 9153515 - 9153563
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||| |||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
9153515 |
ttgcggttaaggacacataaataatttaaatacaaaacagccccctatg |
9153563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #179
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 9169260 - 9169228
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
9169260 |
ctaactaattaaaatacaaaacagccccctatg |
9169228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #180
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 10732347 - 10732315
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
10732347 |
ctaactaattaaaatacaaaacagccccctatg |
10732315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #181
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 14133892 - 14133848
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||| || ||||| ||||||||||||||||| ||||||||| |
|
|
| T |
14133892 |
ggttatggccccctaaccaatttaaatacaaaacacccccctatg |
14133848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #182
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 14770677 - 14770645
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
14770677 |
ctaactaattaaaatacaaaacagccccctatg |
14770645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #183
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 17256622 - 17256654
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
17256622 |
ctaactaattaaaatacaaaacagccccctatg |
17256654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #184
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 17258206 - 17258158
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| || |||||| ||||| |||| |||||||||||||||||||||| |
|
|
| T |
17258206 |
ttgcgattttggacccctaacaaattaaaatacaaaacagccccctatg |
17258158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #185
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 27719946 - 27719914
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
27719946 |
ctaactaatttaaatacaaaacaaccccctatg |
27719914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #186
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 27984177 - 27984225
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| ||| ||||| |
|
|
| T |
27984177 |
ttgcggttatggattcctaactaatttaaatacaaaacaaccctctatg |
27984225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #187
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 32594040 - 32593996
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||| | |||||| |
|
|
| T |
32594040 |
ggttatggccccctaactaatttaaatacaaaacagtctcctatg |
32593996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #188
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 33943588 - 33943620
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
33943588 |
ctaactaattaaaatacaaaacagccccctatg |
33943620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #189
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 34942775 - 34942823
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| | ||||||||||||||||||||||| ||||||||| |
|
|
| T |
34942775 |
ttgcggttatgactccctaactaatttaaatacaaaacaaccccctatg |
34942823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #190
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 280 - 316
Target Start/End: Complemental strand, 34942987 - 34942951
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagc |
316 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||| |
|
|
| T |
34942987 |
ggttatggtcccctaactaatttaaatacaaaacagc |
34942951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #191
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 35495208 - 35495176
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
35495208 |
ctaactaattaaaatacaaaacagccccctatg |
35495176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #192
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 316
Target Start/End: Original strand, 36441520 - 36441560
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagc |
316 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
36441520 |
ttgcggttatggactcctaattaatttaaatacaaaacagc |
36441560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #193
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 312
Target Start/End: Complemental strand, 36441599 - 36441563
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaa |
312 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
36441599 |
ttgcggttatggacccctaactaatttaaatataaaa |
36441563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #194
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 40082250 - 40082298
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| || |||| |||||||||||||||| ||||||||||| |
|
|
| T |
40082250 |
ttgcggttatgatcccctaattaatttaaatacaaaatagccccctatg |
40082298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #195
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 40989598 - 40989566
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
40989598 |
ctaactaattaaaatacaaaacagccccctatg |
40989566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #196
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 42465945 - 42465897
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| || |||||| ||||||||||||||||||| |||||| |
|
|
| T |
42465945 |
ttgcggttatgatcccctaactgatttaaatacaaaacagcctcctatg |
42465897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #197
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 44702126 - 44702094
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
44702126 |
ctaactaattaaaatacaaaacagccccctatg |
44702094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #198
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 46934263 - 46934215
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| |||||| || |||||||||| ||||||||||||||||| |||| |
|
|
| T |
46934263 |
ttgcgattatggccccctaactaattaaaatacaaaacagccccatatg |
46934215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #199
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 46984936 - 46984968
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
46984936 |
ctaactaattaaaatacaaaacagccccctatg |
46984968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #200
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 47284551 - 47284519
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
47284551 |
ctaactaattaaaatacaaaacagccccctatg |
47284519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #201
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 47423403 - 47423355
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||| |||||||||||||||||||||| ||||| |
|
|
| T |
47423403 |
ttgcggttatggtcccataattaatttaaatacaaaacagccctctatg |
47423355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #202
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 48160521 - 48160569
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | |||| |||||||||||||||||| ||| ||||| |
|
|
| T |
48160521 |
ttgcggttatggatccctaattaatttaaatacaaaacaaccctctatg |
48160569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #203
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 49001704 - 49001736
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
49001704 |
ctaactaattaaaatacaaaacagccccctatg |
49001736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #204
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 49002777 - 49002729
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| || |||||| |||||||||| |||||||||||| ||||||||| |
|
|
| T |
49002777 |
ttgcgattttggacccctaactaattaaaatacaaaacacccccctatg |
49002729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #205
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 49859563 - 49859611
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| | ||||||||||||||||||||||||||| ||||| |
|
|
| T |
49859563 |
ttgcggttatgattccctaactaatttaaatacaaaacagcccactatg |
49859611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #206
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 49876256 - 49876224
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
49876256 |
ctaactaattaaaatacaaaacagccccctatg |
49876224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #207
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 51187948 - 51187916
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
51187948 |
ctaactaattaaaatacaaaacagccccctatg |
51187916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #208
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 52613396 - 52613428
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
52613396 |
ctaactaatttaaatacaaaacagcccactatg |
52613428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #209
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 53568332 - 53568380
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| || ||| ||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
53568332 |
ttgcgattttggccctctaactaattaaaatacaaaacagtcccctatg |
53568380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #210
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 53764628 - 53764660
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
53764628 |
ctaactaattaaaatacaaaacagccccctatg |
53764660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #211
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 54476097 - 54476129
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
54476097 |
ctaactaattaaaatacaaaacagccccctatg |
54476129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #212
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 54716530 - 54716562
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
54716530 |
ctaactaattaaaatacaaaacagccccctatg |
54716562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #213
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 55094579 - 55094547
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
55094579 |
ctaactaattaaaatacaaaacagccccctatg |
55094547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 49; Significance: 5e-19; HSPs: 124)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 8519304 - 8519352
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8519304 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
8519352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 274 - 324
Target Start/End: Complemental strand, 45395515 - 45395465
Alignment:
| Q |
274 |
aattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
45395515 |
aattgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
45395465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 1375361 - 1375313
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1375361 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
1375313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 1466848 - 1466896
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1466848 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
1466896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 2382832 - 2382784
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2382832 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
2382784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 2936827 - 2936875
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2936827 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
2936875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 9484739 - 9484787
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9484739 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
9484787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 11362836 - 11362788
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11362836 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
11362788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 21552816 - 21552768
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
21552816 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
21552768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 21568200 - 21568152
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
21568200 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
21568152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 22093273 - 22093321
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
22093273 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
22093321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 25887932 - 25887980
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
25887932 |
ttgcggttatggaccactaactaatttaaatacaaaacagccccctatg |
25887980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 33004747 - 33004795
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33004747 |
ttgcagttatggacctctaactaatttaaatacaaaacagccccctatg |
33004795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 33004967 - 33004919
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33004967 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
33004919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 34123279 - 34123327
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
34123279 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
34123327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 36987688 - 36987640
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36987688 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
36987640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 39431444 - 39431396
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
39431444 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
39431396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 39620583 - 39620631
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
39620583 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
39620631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 40493684 - 40493732
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40493684 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
40493732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 40493920 - 40493872
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40493920 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
40493872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 40711374 - 40711422
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40711374 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
40711422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 41072103 - 41072055
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41072103 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
41072055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 41829740 - 41829692
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41829740 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
41829692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 42445410 - 42445458
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42445410 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
42445458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 42445647 - 42445599
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42445647 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
42445599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 276 - 319
Target Start/End: Complemental strand, 34981657 - 34981614
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccc |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34981657 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccc |
34981614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 276 - 323
Target Start/End: Complemental strand, 35699127 - 35699080
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35699127 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctat |
35699080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 266 - 324
Target Start/End: Complemental strand, 20494621 - 20494563
Alignment:
| Q |
266 |
ataggcttaattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||||| || |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
20494621 |
ataggcttaattgcacttttggacccctaactaatttaaatacaaaacagccccctatg |
20494563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 315056 - 315104
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
315056 |
ttgcggttatggccccctaactaatttaaatacaaaacagccccctatg |
315104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 1374836 - 1374884
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
1374836 |
ttgcggttatggacccctaactaatttaaatacaaaatagccccctatg |
1374884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 2937064 - 2937016
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
2937064 |
ttgcggttatggacccctaactaatttaaatacaaaacagctccctatg |
2937016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 3263291 - 3263243
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
3263291 |
ttgcggttatggccccctaactaatttaaatacaaaacagccccctatg |
3263243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 260 - 324
Target Start/End: Complemental strand, 7538560 - 7538496
Alignment:
| Q |
260 |
taaaaaataggcttaattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||| ||||||||||||| || |||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
7538560 |
taaaaagtaggcttaattgcacttttggacccctaactaatttaaatacaaaacagacccctatg |
7538496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 11366837 - 11366885
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
11366837 |
ttgcggttatggacccctaactaatttaaatacaaaacagccctctatg |
11366885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 13485448 - 13485400
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
13485448 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccttatg |
13485400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 13732442 - 13732394
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
13732442 |
ttgcggttatggacccctaattaatttaaatacaaaacagccccctatg |
13732394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 17799104 - 17799056
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
17799104 |
ttgcggttatggccccctaactaatttaaatacaaaacagccccctatg |
17799056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 19026092 - 19026044
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
19026092 |
ttgcggttatagacccctaactaatttaaatacaaaacagccccctatg |
19026044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 19256864 - 19256816
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
19256864 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccatatg |
19256816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 20494381 - 20494425
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
20494381 |
ggttatggacccctaactaatttaaatacaaaacagccccctatg |
20494425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 21552583 - 21552627
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
21552583 |
ggttatggacccctaactaatttaaatacaaaacagccccctatg |
21552627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 21843455 - 21843407
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
21843455 |
ttgcggttatgaacccctaactaatttaaatacaaaacagccccctatg |
21843407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 22093493 - 22093445
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
22093493 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccctatg |
22093445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 22194486 - 22194534
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
22194486 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccttatg |
22194534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 22194723 - 22194675
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
22194723 |
ttgcggttatggacccctaactaatttaaatacaaaacagccctctatg |
22194675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 22699498 - 22699542
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
22699498 |
ggttatggacccctaactaatttaaatacaaaacagccccctatg |
22699542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 23000784 - 23000736
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
23000784 |
ttgcggttatggccccctaactaatttaaatacaaaacagccccctatg |
23000736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 24895186 - 24895138
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
24895186 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccatatg |
24895138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 31784290 - 31784338
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
31784290 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccctatg |
31784338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 31784526 - 31784478
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
31784526 |
ttgcggttatggacccctaactaatttaaatacaaagcagccccctatg |
31784478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 34123516 - 34123468
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
34123516 |
ttgcggttatggactcctaactaatttaaatacaaaacagccccctatg |
34123468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 36987450 - 36987498
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36987450 |
ttgcgtttatggacccctaactaatttaaatacaaaacagccccctatg |
36987498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 40324672 - 40324720
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40324672 |
ttgcgattatggacccctaactaatttaaatacaaaacagccccctatg |
40324720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 40506241 - 40506289
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
40506241 |
ttgcggttatggccccctaactaatttaaatacaaaacagccccctatg |
40506289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 41071867 - 41071915
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
41071867 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccctatg |
41071915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 41829507 - 41829555
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41829507 |
ttgcggttatggacccataactaatttaaatacaaaacagccccctatg |
41829555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 45127111 - 45127063
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
45127111 |
ttgcagttatggacccctaactaatttaaatacaaaacagccccctatg |
45127063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 276 - 322
Target Start/End: Original strand, 11017643 - 11017689
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccccta |
322 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
11017643 |
ttgcggttatagacccctaactaatttaaatacaaaacagcccccta |
11017689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 282 - 324
Target Start/End: Complemental strand, 13123690 - 13123648
Alignment:
| Q |
282 |
ttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
13123690 |
ttatggacccctaactaatttaaatacaaaacagccccctatg |
13123648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 279 - 324
Target Start/End: Original strand, 1375087 - 1375132
Alignment:
| Q |
279 |
cggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
1375087 |
cggttatggacccctaactaatttaaatacaaaacaaccccctatg |
1375132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 279 - 324
Target Start/End: Complemental strand, 7464211 - 7464166
Alignment:
| Q |
279 |
cggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
7464211 |
cggttatggacccctaactaatttaaatataaaacagccccctatg |
7464166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 279 - 324
Target Start/End: Complemental strand, 25888163 - 25888118
Alignment:
| Q |
279 |
cggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
25888163 |
cggttatggacccctaactaatttaaatacaaaacagacccctatg |
25888118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 267 - 324
Target Start/End: Original strand, 35698883 - 35698940
Alignment:
| Q |
267 |
taggcttaattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| |||||||| || |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35698883 |
taggtttaattgcacttttggacccctaactaatttaaatacaaaacagccccctatg |
35698940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 1467079 - 1467035
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
1467079 |
ggttatggacccctaattaatttaaatacaaaacagccccctatg |
1467035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 5036547 - 5036595
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||| ||||||||| |
|
|
| T |
5036547 |
ttgcggttatggccccctaactaatttaaatacaaaacaaccccctatg |
5036595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 11362599 - 11362647
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
11362599 |
ttgcggttatggacacctaactaatttaaatacaaaacagccccatatg |
11362647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 17798886 - 17798934
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||| |||| |
|
|
| T |
17798886 |
ttgcggttatggccccctaactaatttaaatacaaaacagccccttatg |
17798934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 19368768 - 19368720
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
19368768 |
ttgcggttatgaccccctaactaatttaaatacaaaacagccccctatg |
19368720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 19473290 - 19473242
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
19473290 |
ttgcggttatggccctctaactaatttaaatataaaacagtcccctatg |
19473242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 20436096 - 20436144
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
20436096 |
ttgcagttatggacccctaactaatttaaatacaaaacaaccccctatg |
20436144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 20436328 - 20436280
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| |||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
20436328 |
ttgctgttatggacccctaactaatttaaatataaaacagccccctatg |
20436280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 23000565 - 23000613
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||| ||||||||| |
|
|
| T |
23000565 |
ttgcggttatggccccctaactaatttaaatacaaaacaaccccctatg |
23000613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 25429960 - 25430008
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||| ||||||||| |
|
|
| T |
25429960 |
ttgcggttatggccccctaactaatttaaatacaaaacaaccccctatg |
25430008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 30218981 - 30218933
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
30218981 |
ttgcggttatgaccccctaactaatttaaatacaaaacagccccctatg |
30218933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 34850932 - 34850884
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| ||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
34850932 |
ttgcagttatggccccctaactaatttaaatacaaaacagccccctatg |
34850884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 36566641 - 36566689
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
36566641 |
ttgcggttatggcctcctaactaatttaaatacaaaacagccccctatg |
36566689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 39620823 - 39620775
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||| ||||||||| |
|
|
| T |
39620823 |
ttgcggttatggacccctaactaatttaaatataaaacaaccccctatg |
39620775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 40506459 - 40506411
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||| || || ||||||||||||||||||||||||||||||||| |
|
|
| T |
40506459 |
ttgcggttacggccccctaactaatttaaatacaaaacagccccctatg |
40506411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 45126877 - 45126925
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||| |||| |
|
|
| T |
45126877 |
ttgcggttatggacccctaactaatttaaatacaaaacagtcccttatg |
45126925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 281 - 324
Target Start/End: Original strand, 15977251 - 15977294
Alignment:
| Q |
281 |
gttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
15977251 |
gttatggacccctaactaatttaaatacaaaacagccccttatg |
15977294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 281 - 324
Target Start/End: Original strand, 22136936 - 22136979
Alignment:
| Q |
281 |
gttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
22136936 |
gttatggacccttaactaatttaaatacaaaacagccccctatg |
22136979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 276 - 323
Target Start/End: Original strand, 39431207 - 39431254
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||||||||| |||| |
|
|
| T |
39431207 |
ttgcggttatggacccctaactaattcaaatacaaaacagccctctat |
39431254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 282 - 324
Target Start/End: Original strand, 13732211 - 13732253
Alignment:
| Q |
282 |
ttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
13732211 |
ttatggacccctaactaatttaaatacaaaacagcctcctatg |
13732253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 276 - 318
Target Start/End: Complemental strand, 24205571 - 24205529
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccc |
318 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
24205571 |
ttgcggttatggacccctaattaatttaaatacaaaacagccc |
24205529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 276 - 318
Target Start/End: Complemental strand, 39643004 - 39642962
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccc |
318 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39643004 |
ttgcggttatggacccataactaatttaaatacaaaacagccc |
39642962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 267 - 324
Target Start/End: Complemental strand, 20480386 - 20480329
Alignment:
| Q |
267 |
taggcttaattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| |||||||| || ||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
20480386 |
taggattaattgcacttttggccctctaactaattaaaatacaaaacagccccctatg |
20480329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 315278 - 315230
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| | |||| |||||||||||||||||||||||||||| |
|
|
| T |
315278 |
ttgcggttatggctccctaattaatttaaatacaaaacagccccctatg |
315230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 7537451 - 7537499
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||| || ||||| |
|
|
| T |
7537451 |
ttgcggttacggacccctaactaatttaaatacaaaacagacctctatg |
7537499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 9714922 - 9714954
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
9714922 |
ctaactaatttaaatacaaaacagccccctatg |
9714954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 11367075 - 11367027
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
11367075 |
ttgcggctatggacccataactaatttaaatacaaaacaaccccctatg |
11367027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 13123464 - 13123508
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
13123464 |
ggttatggacccataactaatttaaatacaaaacagtcccctatg |
13123508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 15977480 - 15977436
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| |||| |||||| ||||||||||||||||||||| |
|
|
| T |
15977480 |
ggttatggacccctaagtaatttcaatacaaaacagccccctatg |
15977436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 23049840 - 23049792
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| || ||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
23049840 |
ttgcgattttggacctctaactaattaaaatacaaaacaaccccctatg |
23049792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 312
Target Start/End: Original strand, 24205332 - 24205368
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaa |
312 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24205332 |
ttgcggttatggacccctaactaatttaaatacaaaa |
24205368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 24365145 - 24365097
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||| ||||||||| |
|
|
| T |
24365145 |
ttgcggttatgaccccctaactaatttaaatacaaaacaaccccctatg |
24365097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 316
Target Start/End: Original strand, 24857921 - 24857961
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagc |
316 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
24857921 |
ttgcggttatggactcctaactaatttaaatacaaaacagc |
24857961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 26717214 - 26717246
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
26717214 |
ctaactaatttaaatacaaaacagccccctatg |
26717246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 34981422 - 34981470
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
34981422 |
ttgcggttatagacccttaactaatttaaatacaaaacagtcccctatg |
34981470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 38731333 - 38731365
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
38731333 |
ctaactaatttaaatacaaaacagccccctatg |
38731365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 40445611 - 40445659
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||| ||||||| |
|
|
| T |
40445611 |
ttgcggttatgaccccctaactaatttaaatacaaaacagctccctatg |
40445659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 276 - 319
Target Start/End: Original strand, 19473114 - 19473157
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccc |
319 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||| |||| |
|
|
| T |
19473114 |
ttgcggttatggccccctaactaatttaaatacaaaacaacccc |
19473157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 289 - 324
Target Start/End: Complemental strand, 28451968 - 28451933
Alignment:
| Q |
289 |
cctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28451968 |
cctctaactaattaaaatacaaaacagccccctatg |
28451933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 274 - 324
Target Start/End: Original strand, 8738884 - 8738934
Alignment:
| Q |
274 |
aattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| | | ||||||||||||||||||||||||| ||||||| |
|
|
| T |
8738884 |
aattgcggttatagcctcctaactaatttaaatacaaaacagctccctatg |
8738934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 276 - 314
Target Start/End: Original strand, 39642767 - 39642805
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaaca |
314 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
39642767 |
ttgcggttatggacccctaactaattttaatacaaaaca |
39642805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 3263073 - 3263121
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| | ||||||| |||||||||||||||||||||||| |
|
|
| T |
3263073 |
ttgcggttatggcctcntaactaaattaaatacaaaacagccccctatg |
3263121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 312
Target Start/End: Complemental strand, 1375436 - 1375400
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaa |
312 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
1375436 |
ttgcggttatggacccctaactaaattaaatacaaaa |
1375400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 1380987 - 1380955
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
1380987 |
ctaactaatttaaatacaaaacaaccccctatg |
1380955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 9715124 - 9715076
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||| |||| || ||||||||||||||||||||||| |||| |||| |
|
|
| T |
9715124 |
ttgcggtcatggccccctaactaatttaaatacaaaacaaccccatatg |
9715076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 11188360 - 11188392
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
11188360 |
ctaactaattaaaatacaaaacagccccctatg |
11188392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 14983960 - 14983928
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
14983960 |
ctaactaattaaaatacaaaacagccccctatg |
14983928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 16238166 - 16238198
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
16238166 |
ctaactaattaaaatacaaaacagccccctatg |
16238198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 21633267 - 21633235
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
21633267 |
ctaactaattaaaatacaaaacagccccctatg |
21633235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 26717416 - 26717368
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||||||| |||||||| ||| |||| |
|
|
| T |
26717416 |
ttgcggttatggccccctaactaatttaaatgcaaaacagtcccttatg |
26717368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 32661694 - 32661662
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
32661694 |
ctaactaattaaaatacaaaacagccccctatg |
32661662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 36286413 - 36286381
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
36286413 |
ctaactaattaaaatacaaaacagccccctatg |
36286381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 37343706 - 37343738
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
37343706 |
ctaactaattaaaatacaaaacagccccctatg |
37343738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 37343942 - 37343910
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
37343942 |
ctaactaatttaaatacaaaacaaccccctatg |
37343910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 38731554 - 38731506
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| ||||| |||| |||||||||||||||||||||||| | |||||| |
|
|
| T |
38731554 |
ttgcagttattgacccctaactaatttaaatacaaaacagtctcctatg |
38731506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 39245940 - 39245892
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| |||||||| ||||| |||||||||| |||||||||||||||| |
|
|
| T |
39245940 |
ttgcgattatggactcctaaccaatttaaatataaaacagccccctatg |
39245892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 39374389 - 39374357
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
39374389 |
ctaactaattaaaatacaaaacagccccctatg |
39374357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 312
Target Start/End: Complemental strand, 40711612 - 40711576
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaa |
312 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
40711612 |
ttgcgattatggacccctaactaatttaaatacaaaa |
40711576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 40939080 - 40939048
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
40939080 |
ctaactaattaaaatacaaaacagccccctatg |
40939048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 43890214 - 43890246
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
43890214 |
ctaactaattaaaatacaaaacagccccctatg |
43890246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 312
Target Start/End: Original strand, 45395269 - 45395305
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaa |
312 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
45395269 |
ttgcggttatgtacccctaactaatttaaatacaaaa |
45395305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0951 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: scaffold0951
Description:
Target: scaffold0951; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 3743 - 3791
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3743 |
ttgcggttatggacctctaactaatttaaatacaaaatagccccctatg |
3791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0922 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: scaffold0922
Description:
Target: scaffold0922; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 108 - 60
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
108 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
60 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0606 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: scaffold0606
Description:
Target: scaffold0606; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 6906 - 6954
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6906 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
6954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0474 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: scaffold0474
Description:
Target: scaffold0474; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 7759 - 7807
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7759 |
ttgcggttatggacctctaactaatttaaatacaaaacagtcccctatg |
7807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0474; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 7996 - 7948
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
7996 |
ttgcggttatggacccctaaataatttaaatacaaaacagccccctatg |
7948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0283 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: scaffold0283
Description:
Target: scaffold0283; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 1222 - 1270
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1222 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
1270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0283; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 1459 - 1411
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
1459 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccctatg |
1411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0122 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: scaffold0122
Description:
Target: scaffold0122; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 29688 - 29736
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29688 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
29736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0122; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 279 - 324
Target Start/End: Complemental strand, 29923 - 29878
Alignment:
| Q |
279 |
cggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29923 |
cggttatggacccctaactaatttaaatacaaaacagccccctatg |
29878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0102 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: scaffold0102
Description:
Target: scaffold0102; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 14580 - 14532
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
14580 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
14532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0035 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: scaffold0035
Description:
Target: scaffold0035; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 81577 - 81529
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
81577 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
81529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0035; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 81347 - 81391
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||| |||||||| |
|
|
| T |
81347 |
ggttatggacccctaactaatttaaatataaaacagtcccctatg |
81391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0022 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: scaffold0022
Description:
Target: scaffold0022; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 139449 - 139401
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
139449 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
139401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0022; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 139213 - 139261
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
139213 |
ttgcggttatggacccctaactaatttaaatacaaaacagccacctatg |
139261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 45; Significance: 1e-16; HSPs: 3)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 79262 - 79214
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
79262 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
79214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 12933 - 12885
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||| ||||||||| |
|
|
| T |
12933 |
ttgcggttatggatccctaactaatttaaatacaaaacaaccccctatg |
12885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 79044 - 79076
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
79044 |
ctaactaatttaattacaaaacagccccctatg |
79076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 400981 - 400933
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
400981 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
400933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 400742 - 400790
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
400742 |
ttgcggttatggaacactaactaatttaaatacaaaacagccccctatg |
400790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 45; Significance: 1e-16; HSPs: 173)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 414930 - 414882
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
414930 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
414882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 995031 - 995079
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
995031 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
995079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 1657660 - 1657612
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1657660 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
1657612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 3411439 - 3411487
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3411439 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
3411487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 4132792 - 4132840
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4132792 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
4132840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 4146823 - 4146871
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4146823 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
4146871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 4167475 - 4167427
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4167475 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
4167427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 5734222 - 5734270
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5734222 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
5734270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 5734460 - 5734412
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5734460 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
5734412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 6107392 - 6107344
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6107392 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
6107344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 7151117 - 7151069
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7151117 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
7151069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 8834214 - 8834166
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8834214 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
8834166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 14032074 - 14032122
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
14032074 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
14032122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 16531524 - 16531476
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
16531524 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
16531476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 17943396 - 17943444
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
17943396 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
17943444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 20095724 - 20095772
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
20095724 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
20095772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 20791054 - 20791102
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
20791054 |
ttgcggttatggtcctctaactaatttaaatacaaaacagccccctatg |
20791102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 25249992 - 25250040
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
25249992 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
25250040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 25910316 - 25910364
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
25910316 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
25910364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 29233780 - 29233732
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29233780 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
29233732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 30845835 - 30845787
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30845835 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
30845787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 31191745 - 31191697
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
31191745 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
31191697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 37205578 - 37205626
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37205578 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
37205626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 37205816 - 37205768
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37205816 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
37205768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 37277498 - 37277546
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37277498 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
37277546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 37953648 - 37953600
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37953648 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
37953600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 39515829 - 39515781
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
39515829 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
39515781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 39626005 - 39626053
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
39626005 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
39626053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 39635555 - 39635603
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
39635555 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
39635603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 42267733 - 42267685
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42267733 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
42267685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 42363847 - 42363799
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42363847 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
42363799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 42524983 - 42524935
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42524983 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
42524935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 42906410 - 42906458
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42906410 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
42906458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 42906649 - 42906601
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42906649 |
ttgcggttatggacctctaactaatttaaatacaaaatagccccctatg |
42906601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 44886179 - 44886131
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
44886179 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
44886131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 45209251 - 45209203
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
45209251 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
45209203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 277 - 324
Target Start/End: Complemental strand, 15188203 - 15188156
Alignment:
| Q |
277 |
tgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
15188203 |
tgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
15188156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 414705 - 414753
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
414705 |
ttgcggttatggacccctaactaatttaaatacaaaacagtcccctatg |
414753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 1985607 - 1985655
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
1985607 |
ttgcggttatggacccctaactaatttaaatataaaacagccccctatg |
1985655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 2321554 - 2321602
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
2321554 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccttatg |
2321602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 4133030 - 4132982
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
4133030 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccatatg |
4132982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 4147055 - 4147011
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4147055 |
ggttatggacccctaactaatttaaatacaaaacagccccctatg |
4147011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 6014457 - 6014505
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
6014457 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccctatg |
6014505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 6014693 - 6014645
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
6014693 |
ttgcggttatggacccctaactaatttaaatacaaaacagtcccctatg |
6014645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 6107155 - 6107203
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
6107155 |
ttgcggttatggatccctaactaatttaaatacaaaacagccccctatg |
6107203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 6335603 - 6335555
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6335603 |
ttgcgattatggacccctaactaatttaaatacaaaacagccccctatg |
6335555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 7013625 - 7013577
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7013625 |
ttgcggttatagacccctaactaatttaaatacaaaacagccccctatg |
7013577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 7150880 - 7150928
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7150880 |
ttgcagttatggacccctaactaatttaaatacaaaacagccccctatg |
7150928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 8870297 - 8870345
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8870297 |
ttgcggttatggacccttaactaatttaaatacaaaacagccccctatg |
8870345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 8870536 - 8870488
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8870536 |
ttgcggttatggacccttaactaatttaaatacaaaacagccccctatg |
8870488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 320
Target Start/End: Original strand, 12330111 - 12330155
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccc |
320 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12330111 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccc |
12330155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 14024315 - 14024267
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
14024315 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccctatg |
14024267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 18553246 - 18553198
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
18553246 |
ttgcggttatggacccctaactaatttaaatacaaaacagccctctatg |
18553198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 20095962 - 20095914
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
20095962 |
ttgcggttatgggcccctaactaatttaaatacaaaacagccccctatg |
20095914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 23234055 - 23234007
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
23234055 |
ttgcggttatggacccctaactaatttaaatacaaaacagacccctatg |
23234007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 27339581 - 27339629
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
27339581 |
ttgcggttatggacccctaactaatttaaatacaaaatagccccctatg |
27339629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 27822913 - 27822961
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
27822913 |
ttgcggttatggacccctaactaatttaaatacaaaacatccccctatg |
27822961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 27872748 - 27872796
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
27872748 |
ttgcggttatggatccctaactaatttaaatacaaaacagccccctatg |
27872796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 29233580 - 29233628
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29233580 |
ttgcggttatgtacccctaactaatttaaatacaaaacagccccctatg |
29233628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 30358881 - 30358929
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
30358881 |
ttgcggttatggacccataactaatttaaatacaaaacagccccctatg |
30358929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 30359117 - 30359069
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
30359117 |
ttgcggttatggacccctaactaatttaaatacaaaacagctccctatg |
30359069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 35735541 - 35735589
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
35735541 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccctatg |
35735589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 36226686 - 36226642
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36226686 |
ggttatggacccctaactaatttaaatacaaaacagccccctatg |
36226642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 36801435 - 36801483
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
36801435 |
ttgcggttatggacccctaactaatttaaatacaaaacagtcccctatg |
36801483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 37953412 - 37953460
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
37953412 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccctatg |
37953460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 38166522 - 38166570
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
38166522 |
ttgcggttatggacccctaactaatttaaatacaaaacagtcccctatg |
38166570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 38166761 - 38166713
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
38166761 |
ttgcggttatggacccctaattaatttaaatacaaaacagccccctatg |
38166713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 38593460 - 38593412
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38593460 |
ttgcggttattgacccctaactaatttaaatacaaaacagccccctatg |
38593412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 39616826 - 39616778
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
39616826 |
ttgcggttatggccccctaactaatttaaatacaaaacagccccctatg |
39616778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 41015066 - 41015018
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
41015066 |
ttgcggttatggccccctaactaatttaaatacaaaacagccccctatg |
41015018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 41625498 - 41625546
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
41625498 |
ttgcggttatggacccctaattaatttaaatacaaaacagccccctatg |
41625546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 42642363 - 42642315
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
42642363 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccttatg |
42642315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 44885942 - 44885990
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
44885942 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccctatg |
44885990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 45106473 - 45106521
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
45106473 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccctatg |
45106521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 45209014 - 45209062
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
45209014 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccttatg |
45209062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 45480327 - 45480279
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
45480327 |
ttgcggttatggacccctaactaatttaaatacaaaacagcccactatg |
45480279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 276 - 323
Target Start/End: Complemental strand, 995269 - 995222
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
995269 |
ttgcggttatggacccctaactaatttaaatacaaaacagtcccctat |
995222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 276 - 323
Target Start/End: Complemental strand, 20283950 - 20283903
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
20283950 |
ttgcggttatggccccctaactaatttaaatacaaaacagccccctat |
20283903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 276 - 323
Target Start/End: Original strand, 20819790 - 20819837
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
20819790 |
ttgcggttatggacccctaactaatttaaatacaaaacagtcccctat |
20819837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 276 - 323
Target Start/End: Complemental strand, 21070578 - 21070531
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
21070578 |
ttgcggttatggccccctaactaatttaaatacaaaacagccccctat |
21070531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 261 - 324
Target Start/End: Complemental strand, 35735792 - 35735729
Alignment:
| Q |
261 |
aaaaaataggcttaattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||| | |||||||||| || |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35735792 |
aaaaaaaaagcttaattgcacttttggacccctaactaatttaaatacaaaacagccccctatg |
35735729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 277 - 324
Target Start/End: Complemental strand, 39626242 - 39626195
Alignment:
| Q |
277 |
tgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
39626242 |
tgcggttatggacccctaactaatttaaatacaaaacagtcccctatg |
39626195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 277 - 324
Target Start/End: Complemental strand, 39635792 - 39635745
Alignment:
| Q |
277 |
tgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
39635792 |
tgcggttatggacccctaactaatttaaatacaaaacagtcccctatg |
39635745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 282 - 324
Target Start/End: Original strand, 33947088 - 33947130
Alignment:
| Q |
282 |
ttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33947088 |
ttatggacccctaactaatttaaatacaaaacagccccctatg |
33947130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 280 - 322
Target Start/End: Original strand, 41574197 - 41574239
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagcccccta |
322 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41574197 |
ggttatggacccctaactaatttaaatacaaaacagcccccta |
41574239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 276 - 317
Target Start/End: Original strand, 6641634 - 6641675
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcc |
317 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6641634 |
ttgcggttatggacccctaactaatttaaatacaaaacagcc |
6641675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 267 - 324
Target Start/End: Original strand, 18553000 - 18553057
Alignment:
| Q |
267 |
taggcttaattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| || |||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
18553000 |
taggcttaattgcacttttggacccctaactaatttaaatacaaaacaaccccctatg |
18553057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 1985844 - 1985796
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||| ||||||||| |
|
|
| T |
1985844 |
ttgcggttatggacccctaattaatttaaatacaaaacaaccccctatg |
1985796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 2321788 - 2321744
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2321788 |
ggttatgaacccctaactaatttaaatacaaaacagccccctatg |
2321744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 6335370 - 6335418
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||| |||||||| |
|
|
| T |
6335370 |
ttgcggttatggatccctaactaatttaaatacaaaacagtcccctatg |
6335418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 6641873 - 6641825
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
6641873 |
ttgcggttatgaacccctaactaatttaaatacaaaacaaccccctatg |
6641825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 6655553 - 6655505
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
6655553 |
ttgcggtaatggacccctaactaatttaaatacaaaacagctccctatg |
6655505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 6735955 - 6735907
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
6735955 |
ttgcggtaatggacccctaactaatttaaatacaaaacagctccctatg |
6735907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 7013387 - 7013435
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||| |||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
7013387 |
ttgcggttttggacccctaactattttaaatacaaaacagccccctatg |
7013435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 7653631 - 7653583
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||| |||||||| |
|
|
| T |
7653631 |
ttgcggttatggccccctaactaatttaaatacaaaacagtcccctatg |
7653583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 8833980 - 8834028
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8833980 |
ttgcggttatggactcataactaatttaaatacaaaacagccccctatg |
8834028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 15187966 - 15188014
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||| |||||||| |
|
|
| T |
15187966 |
ttgcggttatggatccctaactaatttaaatacaaaacagtcccctatg |
15188014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 279 - 323
Target Start/End: Complemental strand, 18531105 - 18531061
Alignment:
| Q |
279 |
cggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
18531105 |
cggttatgaacccctaactaatttaaatacaaaacagccccctat |
18531061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 20056449 - 20056497
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||| |||| |
|
|
| T |
20056449 |
ttgcggttatggacccctaactaatttaaatacaaaacagtcccttatg |
20056497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 20791273 - 20791225
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
20791273 |
ttgcggttatgaccccctaactaatttaaatacaaaacagccccctatg |
20791225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 20813774 - 20813822
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
20813774 |
ttgcggttatggacccctaactaatttaaatacaaaacagttccctatg |
20813822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 25250221 - 25250173
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
25250221 |
ttgcggttatagacccctaactaatttaaatacaaaacagtcccctatg |
25250173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 27339818 - 27339770
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
27339818 |
ttgcggttatggacccttaactaatttaaatacaaaacagacccctatg |
27339770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 28596201 - 28596157
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
28596201 |
ggttatggacccctaactaatttaaatacaaaacagtcccctatg |
28596157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 30845592 - 30845640
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||| ||||||| |
|
|
| T |
30845592 |
ttgcggttatggatccctaactaatttaaatacaaaacagctccctatg |
30845640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 31190681 - 31190729
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
31190681 |
ttgcggttatagacccctaactaatttaaatacaaaatagccccctatg |
31190729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 32332178 - 32332226
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||| |||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
32332178 |
ttgcggttttggacccctaactaatttaaaaacaaaacagccccctatg |
32332226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 33881362 - 33881314
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| || ||||| |
|
|
| T |
33881362 |
ttgcggttatggacccctaactaatttaaatacaaaacagtcctctatg |
33881314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 36788292 - 36788340
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
36788292 |
ttgcggttatagacccctaactaatttaaatacaaaacatccccctatg |
36788340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 36788527 - 36788479
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||| ||||| |
|
|
| T |
36788527 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccctctatg |
36788479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 36801639 - 36801595
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
36801639 |
ggttatggatccctaactaatttaaatacaaaacagccccctatg |
36801595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 38593225 - 38593273
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
38593225 |
ttgcggttatggacccttaactaatttaaatacaaaacagccctctatg |
38593273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 316
Target Start/End: Original strand, 39515596 - 39515636
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagc |
316 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39515596 |
ttgcggttatggacccctaactaatttaaatacaaaacagc |
39515636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 41014848 - 41014896
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||| |||||||| |
|
|
| T |
41014848 |
ttgcggttatggccccctaactaatttaaatacaaaacagacccctatg |
41014896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 41554645 - 41554693
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||| ||||||||| |
|
|
| T |
41554645 |
ttgcggttatggccccctaactaatttaaatacaaaacaaccccctatg |
41554693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 41788689 - 41788737
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
41788689 |
ttgcagttatggacccctaactaatttaaatacaaaacaaccccctatg |
41788737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 42267498 - 42267542
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
42267498 |
ggttatggacccctaactaatttaaatacaaaacaaccccctatg |
42267542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 42524748 - 42524796
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| |||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42524748 |
ttgcgattatagacccctaactaatttaaatacaaaacagccccctatg |
42524796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 45106710 - 45106662
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||| ||||||||| |
|
|
| T |
45106710 |
ttgcggttatggatccctaactaatttaaatacaaaacaaccccctatg |
45106662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 45516195 - 45516147
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
45516195 |
ttgcggttatgaacccctaactaatttaaatacaaaacaaccccctatg |
45516147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 276 - 319
Target Start/End: Original strand, 42363616 - 42363659
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccc |
319 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42363616 |
ttgctgttatggacccctaactaatttaaatacaaaacagcccc |
42363659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 285 - 323
Target Start/End: Complemental strand, 20057245 - 20057207
Alignment:
| Q |
285 |
tggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
20057245 |
tggacccctaactaatttaaatacaaaacagccccctat |
20057207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 279 - 324
Target Start/End: Original strand, 40918434 - 40918479
Alignment:
| Q |
279 |
cggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||| |||||||| |
|
|
| T |
40918434 |
cggttatggccccctaactaatttaaatacaaaacagtcccctatg |
40918479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 276 - 321
Target Start/End: Original strand, 41206200 - 41206245
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccct |
321 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||| |||||| |
|
|
| T |
41206200 |
ttgcggttatggccccctaactaatttaaatacaaaacaaccccct |
41206245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 276 - 317
Target Start/End: Complemental strand, 41574427 - 41574386
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcc |
317 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41574427 |
ttgcgattatggacccctaactaatttaaatacaaaacagcc |
41574386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 280 - 317
Target Start/End: Original strand, 42642134 - 42642171
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagcc |
317 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42642134 |
ggttatggacccctaactaatttaaatacaaaacagcc |
42642171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 1657430 - 1657474
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||| |||||||| |
|
|
| T |
1657430 |
ggttatggacccctaactaatttaaatataaaacagtcccctatg |
1657474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 4107123 - 4107076
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
4107123 |
ttgcggttatg-acccctaactaatttaaatacaaaacagccccatatg |
4107076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 4167246 - 4167290
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
4167246 |
ggttattgacccctaactaatttaaatacaaaacaaccccctatg |
4167290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 6655314 - 6655362
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||| || |||||| |
|
|
| T |
6655314 |
ttgcggttatggacccctaactaatttagatacaaaacaacctcctatg |
6655362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 6735716 - 6735764
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||| || |||||| |
|
|
| T |
6735716 |
ttgcggttatggacccctaactaatttagatacaaaacaacctcctatg |
6735764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 272 - 324
Target Start/End: Original strand, 6745025 - 6745077
Alignment:
| Q |
272 |
ttaattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||| || |||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
6745025 |
ttaattgcacttttggacccctaactaatttaaatacaaaacagtcccctatg |
6745077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 6745269 - 6745221
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||| || |||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
6745269 |
ttgcggtaatagacccctaactaatttaaatacaaaacagctccctatg |
6745221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 8287879 - 8287831
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| | ||||||||| |
|
|
| T |
8287879 |
ttgcggttatggacccttaactaatttaaatacaaaataaccccctatg |
8287831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 14032304 - 14032260
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||| |||||||| |
|
|
| T |
14032304 |
ggttatggacccctaactaatttaaatataaaacagtcccctatg |
14032260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 20820027 - 20819980
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||| |||| |
|
|
| T |
20820027 |
ttgcggttatggacc-ctaactaatttaaatacaaaacaaccccatatg |
20819980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 27872984 - 27872936
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
27872984 |
ttgcagttatggactcctaactaatttaaatacaaaacagccctctatg |
27872936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 32318781 - 32318733
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
32318781 |
ttgcggttatgaacccttaactaatttaaatacaaaacagccctctatg |
32318733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 33877767 - 33877723
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
33877767 |
ggttatggactcctaactaatttaaatacaaaacagccccttatg |
33877723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 35409751 - 35409799
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |||||| |||| |
|
|
| T |
35409751 |
ttgcggttatgaccctctaactaatttaaatacaaaagagccccatatg |
35409799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 37277731 - 37277687
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| || |||||| |
|
|
| T |
37277731 |
ggttatggacccctaactaatttaaatacaaaacaacctcctatg |
37277687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 37639549 - 37639593
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37639549 |
ggttttggacccttaactaatttaaatacaaaacagccccctatg |
37639593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 40918649 - 40918601
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||||| ||||| |
|
|
| T |
40918649 |
ttgcggttatgaccccctaactaatttaaatacaaaacagccctctatg |
40918601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 41206407 - 41206360
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||||||||| ||||||||||||||| |
|
|
| T |
41206407 |
ttgcggttatggccccctaactaatttaaatac-aaacagccccctatg |
41206360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 41625732 - 41625688
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
41625732 |
ggttattgacccctaactaatttaaatacaaaacagccccatatg |
41625688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 41788922 - 41788874
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | |||| |||||||||||||||||||||| ||||| |
|
|
| T |
41788922 |
ttgcggttatggatccctaattaatttaaatacaaaacagccctctatg |
41788874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 277 - 324
Target Start/End: Original strand, 7653415 - 7653462
Alignment:
| Q |
277 |
tgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||| |||| |
|
|
| T |
7653415 |
tgcggttatggtaccctaactaatttaaatacaaaacagccccttatg |
7653462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 276 - 323
Target Start/End: Complemental strand, 41693327 - 41693280
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
||||||||||| | | |||||||||||||||||||||||| ||||||| |
|
|
| T |
41693327 |
ttgcggttatgaagccctaactaatttaaatacaaaacaggcccctat |
41693280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 289 - 324
Target Start/End: Complemental strand, 45309584 - 45309549
Alignment:
| Q |
289 |
cctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45309584 |
cctctaactaattaaaatacaaaacagccccctatg |
45309549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 276 - 314
Target Start/End: Original strand, 14024230 - 14024268
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaaca |
314 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
14024230 |
ttgcggttatggacccctaaataatttaaatacaaaaca |
14024268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 290 - 324
Target Start/End: Complemental strand, 20504697 - 20504663
Alignment:
| Q |
290 |
ctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
20504697 |
ctctaactaattaaaatacaaaacagccccctatg |
20504663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 276 - 314
Target Start/End: Original strand, 29454382 - 29454420
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaaca |
314 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29454382 |
ttgcggttatggactcctaactaatttaaatacaaaaca |
29454420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 275 - 324
Target Start/End: Original strand, 4106906 - 4106954
Alignment:
| Q |
275 |
attgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||| ||||| || |||||||||||||||||||||||| |||||||| |
|
|
| T |
4106906 |
attgcgggtatggccc-ctaactaatttaaatacaaaacagtcccctatg |
4106954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 290 - 323
Target Start/End: Complemental strand, 5548152 - 5548119
Alignment:
| Q |
290 |
ctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
5548152 |
ctctaactaattaaaatacaaaacagccccctat |
5548119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 279 - 324
Target Start/End: Complemental strand, 17943611 - 17943566
Alignment:
| Q |
279 |
cggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||| || ||||||||||||||||||||| ||||||||||| |
|
|
| T |
17943611 |
cggttatgaccccctaactaatttaaatacaaaatagccccctatg |
17943566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #156
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 5577559 - 5577527
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
5577559 |
ctaactaatttaaatacaaaacggccccctatg |
5577527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #157
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 5916916 - 5916884
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
5916916 |
ctaactaattaaaatacaaaacagccccctatg |
5916884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #158
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 8287657 - 8287689
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
8287657 |
ctaactaatttaaatacaaaacagcctcctatg |
8287689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #159
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 12278889 - 12278921
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
12278889 |
ctaactaattaaaatacaaaacagccccctatg |
12278921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #160
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 12280301 - 12280269
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
12280301 |
ctaactaattaaaatacaaaacagccccctatg |
12280269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #161
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 20813995 - 20813963
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
20813995 |
ctaactaatttaaatagaaaacagccccctatg |
20813963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #162
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 23233819 - 23233867
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| || | ||||||||||||||||||||| |||||||||| |
|
|
| T |
23233819 |
ttgcggttatagatccctaactaatttaaatacaaaatggccccctatg |
23233867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #163
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 27300777 - 27300745
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
27300777 |
ctaactaattaaaatacaaaacagccccctatg |
27300745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #164
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 28595968 - 28596016
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||| | |||||| |
|
|
| T |
28595968 |
ttgcggttatggatccttaactaatttaaatacaaaacagtcacctatg |
28596016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #165
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 32318544 - 32318591
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||| || ||||||||| |
|
|
| T |
32318544 |
ttgcggttatgaacc-ctaactaatttaaatacaaatcaaccccctatg |
32318591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #166
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 32498431 - 32498463
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
32498431 |
ctaactaattaaaatacaaaacagccccctatg |
32498463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #167
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 38701921 - 38701889
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
38701921 |
ctaactaattaaaatacaaaacagccccctatg |
38701889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #168
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 40021569 - 40021601
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
40021569 |
ctaactaattaaaatacaaaacagccccctatg |
40021601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #169
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 41368405 - 41368437
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
41368405 |
ctaactaattaaaatacaaaacagccccctatg |
41368437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #170
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 41368641 - 41368609
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
41368641 |
ctaactaattaaaatacaaaacagccccctatg |
41368609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #171
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 267 - 319
Target Start/End: Original strand, 44807100 - 44807152
Alignment:
| Q |
267 |
taggcttaattgcggttatggacctctaactaatttaaatacaaaacagcccc |
319 |
Q |
| |
|
||||||||||||| || ||| || |||||||||| ||||||||||||||||| |
|
|
| T |
44807100 |
taggcttaattgcacttttggccccctaactaattaaaatacaaaacagcccc |
44807152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #172
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 44807334 - 44807302
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
44807334 |
ctaactaattaaaatacaaaacagccccctatg |
44807302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #173
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 45308508 - 45308540
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
45308508 |
ctaactaattaaaatacaaaacagccccctatg |
45308540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 45; Significance: 1e-16; HSPs: 183)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 14778 - 14826
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
14778 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
14826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 4243168 - 4243216
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4243168 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
4243216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 6491691 - 6491643
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6491691 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
6491643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 8028998 - 8029046
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8028998 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
8029046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 8535570 - 8535614
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8535570 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
8535614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 8600809 - 8600853
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8600809 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
8600853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 8774336 - 8774384
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8774336 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
8774384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 9053677 - 9053629
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9053677 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
9053629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 9517521 - 9517473
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9517521 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
9517473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 11018439 - 11018487
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11018439 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
11018487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 11052172 - 11052124
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11052172 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
11052124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 11204545 - 11204593
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11204545 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
11204593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 11204774 - 11204726
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11204774 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
11204726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 13791614 - 13791662
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
13791614 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
13791662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 14460577 - 14460529
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
14460577 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
14460529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 19830386 - 19830338
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
19830386 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
19830338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 21727890 - 21727842
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
21727890 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
21727842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 22204343 - 22204391
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
22204343 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
22204391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 23208346 - 23208394
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
23208346 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
23208394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 23342002 - 23342050
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
23342002 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
23342050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 23342236 - 23342188
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
23342236 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
23342188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 23356731 - 23356779
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
23356731 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
23356779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 23356969 - 23356921
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
23356969 |
ttgcggttatggacctctaactaatttaaatacaaaatagccccctatg |
23356921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 36139632 - 36139584
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36139632 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
36139584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 38622678 - 38622630
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38622678 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
38622630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 39427688 - 39427640
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
39427688 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
39427640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 42406921 - 42406969
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42406921 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
42406969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 42407160 - 42407112
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42407160 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
42407112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 45885224 - 45885176
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
45885224 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
45885176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 47113426 - 47113474
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
47113426 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
47113474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 47113662 - 47113614
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
47113662 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
47113614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 49056162 - 49056210
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
49056162 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
49056210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 51272715 - 51272763
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
51272715 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
51272763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 52149555 - 52149603
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
52149555 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctatg |
52149603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 276 - 323
Target Start/End: Original strand, 32341533 - 32341580
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32341533 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctat |
32341580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 276 - 323
Target Start/End: Complemental strand, 34988361 - 34988314
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34988361 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccctat |
34988314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 274 - 324
Target Start/End: Original strand, 31797100 - 31797150
Alignment:
| Q |
274 |
aattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
31797100 |
aattgcggttatggaccccaaactaatttaaatacaaaacagccccctatg |
31797150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 279 - 324
Target Start/End: Original strand, 3264041 - 3264086
Alignment:
| Q |
279 |
cggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3264041 |
cggttatggacccctaactaatttaaatacaaaacagccccctatg |
3264086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 15012 - 14965
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
15012 |
ttgcggttatggacc-ctaactaatttaaatacaaaacagccccctatg |
14965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 2371215 - 2371263
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
2371215 |
ttgcggttatggacccctaactaatttaaatataaaacagccccctatg |
2371263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 6183020 - 6183068
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
6183020 |
ttgcggttatggatccctaactaatttaaatacaaaacagccccctatg |
6183068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 6183257 - 6183209
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6183257 |
ttgcggttaaggacccctaactaatttaaatacaaaacagccccctatg |
6183209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 6809106 - 6809154
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
6809106 |
ttgcggttatggacccctaactaatttaaatacaaaacagccacctatg |
6809154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 6809340 - 6809296
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6809340 |
ggttatggacccctaactaatttaaatacaaaacagccccctatg |
6809296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 7598647 - 7598695
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
7598647 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccctatg |
7598695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 7598881 - 7598833
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7598881 |
ttgcggttatggacccataactaatttaaatacaaaacagccccctatg |
7598833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 8535791 - 8535743
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
8535791 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccatatg |
8535743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 8601030 - 8600982
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
8601030 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccatatg |
8600982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 8770501 - 8770549
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8770501 |
ttgcggttatggacccttaactaatttaaatacaaaacagccccctatg |
8770549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 8770738 - 8770690
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8770738 |
ttgcggttatggacccttaactaatttaaatacaaaacagccccctatg |
8770690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 9053439 - 9053487
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
9053439 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccctatg |
9053487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 9058204 - 9058252
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
9058204 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccctatg |
9058252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 9517288 - 9517336
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
9517288 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccatatg |
9517336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 11018677 - 11018629
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
11018677 |
ttgcggttatggacccctaactaatttaaatacaaaacagctccctatg |
11018629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 12690063 - 12690107
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12690063 |
ggttatggacccctaactaatttaaatacaaaacagccccctatg |
12690107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 13791850 - 13791802
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
13791850 |
ttgcggttatggacccctaactaatttaaatacaaaacagccacctatg |
13791802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 14460339 - 14460387
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
14460339 |
ttgcagttatggacccctaactaatttaaatacaaaacagccccctatg |
14460387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 15161335 - 15161383
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
15161335 |
ttgcggttatggacccctaactaatttaaatacaaaacagccctctatg |
15161383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 15161573 - 15161525
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
15161573 |
ttgcggttatggacccctaactaatttaaatacaaagcagccccctatg |
15161525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 16491012 - 16491060
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
16491012 |
ttgcggttatgaacccctaactaatttaaatacaaaacagccccctatg |
16491060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 20224116 - 20224164
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
20224116 |
ttgcggttatggactcctaactaatttaaatacaaaacagccccctatg |
20224164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 20224351 - 20224303
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
20224351 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccttatg |
20224303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 20471452 - 20471500
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
20471452 |
ttgcggttatggacccctaactaatttaaatacaaaacagtcccctatg |
20471500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 20560085 - 20560037
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
20560085 |
ttgcggttatggacccctaactaatttaaatacaaaacagtcccctatg |
20560037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 20596138 - 20596090
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
20596138 |
ttgcggttatggacccctaactaatttaaaaacaaaacagccccctatg |
20596090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 23792818 - 23792866
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
23792818 |
ttgcggttatggacctctaactaatttaaatataaaacagctccctatg |
23792866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 26861312 - 26861360
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
26861312 |
ttgcggttatggacccctaactaatttaaatacaaaacagtcccctatg |
26861360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 28503173 - 28503221
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
28503173 |
ttgcggttatggacccctaactaatttaaatacaaaacagtcccctatg |
28503221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 30288245 - 30288293
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
30288245 |
ttgcggttatggacccctaactaatttaaatacaaaacagctccctatg |
30288293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 32341767 - 32341719
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
32341767 |
ttgcggttatggacccctaactaatttaaatgcaaaacagccccctatg |
32341719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 33811463 - 33811511
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33811463 |
ttgcggtcatggacccctaactaatttaaatacaaaacagccccctatg |
33811511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 33870932 - 33870980
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33870932 |
ttgcggtcatggacccctaactaatttaaatacaaaacagccccctatg |
33870980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 36139404 - 36139452
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
36139404 |
ttgcggttatggacccctaactaatttaaatacaaaacagccctctatg |
36139452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 37028966 - 37029014
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37028966 |
ttgcagttatggacccctaactaatttaaatacaaaacagccccctatg |
37029014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 37029203 - 37029155
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
37029203 |
ttgcggttatggacccctaactaatttaaatacaaaatagccccctatg |
37029155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 40355886 - 40355934
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
40355886 |
ttgcggttatggacccctaactaacttaaatacaaaacagccccctatg |
40355934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 40356120 - 40356076
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40356120 |
ggttatggacccctaactaatttaaatacaaaacagccccctatg |
40356076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 41585323 - 41585371
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
41585323 |
ttgcggttatggatccctaactaatttaaatacaaaacagccccctatg |
41585371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 41585560 - 41585512
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
41585560 |
ttgcggttatggacccctaactaatttaaatacaaaacagcaccctatg |
41585512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 43677141 - 43677189
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43677141 |
ttgcggttatgaacccctaactaatttaaatacaaaacagccccctatg |
43677189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 43677377 - 43677329
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43677377 |
ttgcggttatgaacccctaactaatttaaatacaaaacagccccctatg |
43677329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 43914616 - 43914664
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
43914616 |
ttgcggttatggatccctaactaatttaaatacaaaacagccccctatg |
43914664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 44846956 - 44847004
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
44846956 |
ttgcggttatggacccctaactaatttaaatataaaacagccccctatg |
44847004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 44847189 - 44847141
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
44847189 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccctatg |
44847141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 45664197 - 45664245
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45664197 |
ttgcggttatggccctctaactaatttaaatacaaaacaaccccctatg |
45664245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 45884986 - 45885034
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
45884986 |
ttgcggttatggacccctaactaatttaaatacaaaacagccctctatg |
45885034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 46320951 - 46320903
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
46320951 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccctatg |
46320903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 49056397 - 49056349
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
49056397 |
ttgcggttatggacccctaactaatttaaatacaaaacagtcccctatg |
49056349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 51272953 - 51272905
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
51272953 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccttatg |
51272905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 52143203 - 52143251
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
52143203 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccctatg |
52143251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 52149789 - 52149741
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
52149789 |
ttgcggttatggacccctaattaatttaaatacaaaacagccccctatg |
52149741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 276 - 323
Target Start/End: Original strand, 9332941 - 9332987
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
9332941 |
ttgcggttatggacc-ctaactaatttaaatacaaaacagccccctat |
9332987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 276 - 323
Target Start/End: Original strand, 9356714 - 9356760
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
9356714 |
ttgcggttatggacc-ctaactaatttaaatacaaaacagccccctat |
9356760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 276 - 323
Target Start/End: Complemental strand, 27396801 - 27396754
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
27396801 |
ttgcggttatggatccctaactaatttaaatacaaaacagccccctat |
27396754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 276 - 319
Target Start/End: Original strand, 32558250 - 32558293
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccc |
319 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32558250 |
ttgcggttatggacccctaactaatttaaatacaaaacagcccc |
32558293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 276 - 319
Target Start/End: Original strand, 36230590 - 36230633
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccc |
319 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36230590 |
ttgcggttatggccctctaactaatttaaatacaaaacagcccc |
36230633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 281 - 323
Target Start/End: Complemental strand, 22071429 - 22071387
Alignment:
| Q |
281 |
gttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
22071429 |
gttatggacccctaactaatttaaatacaaaacagccccctat |
22071387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 276 - 322
Target Start/End: Original strand, 29794731 - 29794777
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccccta |
322 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29794731 |
ttgcagttatggacccctaactaatttaaatacaaaacagcccccta |
29794777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 276 - 322
Target Start/End: Original strand, 34988128 - 34988174
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccccta |
322 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34988128 |
ttgcggttatgaacccctaactaatttaaatacaaaacagcccccta |
34988174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 278 - 324
Target Start/End: Complemental strand, 49227389 - 49227343
Alignment:
| Q |
278 |
gcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
49227389 |
gcggttatggacccctaactaatttaaatacaaaacagccctctatg |
49227343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 279 - 324
Target Start/End: Complemental strand, 27855815 - 27855770
Alignment:
| Q |
279 |
cggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
27855815 |
cggttatgatcctctaactaatttaaatacaaaacagccccctatg |
27855770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 279 - 324
Target Start/End: Complemental strand, 28503408 - 28503363
Alignment:
| Q |
279 |
cggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
28503408 |
cggttatggacccctaactaatttaaatacaaaacagccccatatg |
28503363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 921791 - 921839
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
921791 |
ttgcggttatgaacccctaactaatttaaatacaaaacagcctcctatg |
921839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 922438 - 922390
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||| |||| |
|
|
| T |
922438 |
ttgcggttatggatccctaactaatttaaatacaaaacagccccatatg |
922390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 320
Target Start/End: Complemental strand, 2372687 - 2372643
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccc |
320 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
2372687 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccc |
2372643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 320
Target Start/End: Original strand, 2383384 - 2383428
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccc |
320 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
2383384 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccc |
2383428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 8774572 - 8774524
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| |||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8774572 |
ttgcagttatgaacccctaactaatttaaatacaaaacagccccctatg |
8774524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 11051934 - 11051982
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
11051934 |
ttgcggttattgacccctaactaatttaaatacaaaacagccccttatg |
11051982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 13098069 - 13098117
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
13098069 |
ttgcggttatgaccccctaactaatttaaatacaaaacagccccctatg |
13098117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 16491250 - 16491202
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||| |||||||| |
|
|
| T |
16491250 |
ttgcggttatggatccctaactaatttaaatacaaaacagtcccctatg |
16491202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 20287805 - 20287853
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
20287805 |
ttgcggttatgaacccctaactaatttaaatacaaaatagccccctatg |
20287853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 20359273 - 20359225
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
20359273 |
ttgcggttatggactcctaactaatttaaatacaaaacagcaccctatg |
20359225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 316
Target Start/End: Complemental strand, 20471687 - 20471647
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagc |
316 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
20471687 |
ttgcggttatggacccctaactaatttaaatacaaaacagc |
20471647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 20551697 - 20551745
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
20551697 |
ttgcggttatggactcctaactaatttaaatacaaaacagcaccctatg |
20551745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 316
Target Start/End: Original strand, 20559850 - 20559890
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagc |
316 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
20559850 |
ttgcggttatggacccctaactaatttaaatacaaaacagc |
20559890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 21727654 - 21727698
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
21727654 |
ggttatgaacctctaactaatttaaatacaaaacagccccatatg |
21727698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 23793057 - 23793009
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
23793057 |
ttgcggttatggactcctaactaatttaaatacaaaacagccccatatg |
23793009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 25820148 - 25820196
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
25820148 |
ttgcggttacggacctctaactaatttaaatacaaaacagacccttatg |
25820196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 25820828 - 25820780
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
25820828 |
ttgcggttacggacctctaactaatttaaatacaaaacagacccttatg |
25820780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 27855601 - 27855648
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
27855601 |
ttgcggttatg-acccctaactaatttaaatacaaaacagccccctatg |
27855648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 29704655 - 29704703
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
29704655 |
ttgcggttatagacccctaactaatttaaatacaaaacagccccttatg |
29704703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 29794969 - 29794921
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||| |||| |
|
|
| T |
29794969 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccttatg |
29794921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 30288474 - 30288426
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
30288474 |
ttgcggttatgaacccctaactaatttaaatacaaaatagccccctatg |
30288426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 30294908 - 30294956
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||| ||||||||||| |
|
|
| T |
30294908 |
ttgcggttatggatccctaactaatttaaatacaaaatagccccctatg |
30294956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 32037885 - 32037929
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32037885 |
ggttatggatctctaactaatttaaatacaaaagagccccctatg |
32037929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 38622441 - 38622489
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38622441 |
ttgcagttatggactcctaactaatttaaatacaaaacagccccctatg |
38622489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 39427449 - 39427497
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||| ||||||||| |
|
|
| T |
39427449 |
ttgcggttatggatccctaactaatttaaatacaaaacaaccccctatg |
39427497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 40814924 - 40814972
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || |||| |||||||||||||||||||||||||||| |
|
|
| T |
40814924 |
ttgcggttatggccccctaattaatttaaatacaaaacagccccctatg |
40814972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 43914851 - 43914807
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
43914851 |
ggttatggacccctaactaatttaaatacaaaatagccccctatg |
43914807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 45664415 - 45664367
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||| |||||||| |
|
|
| T |
45664415 |
ttgcggttatggccccctaactaatttaaatacaaaacagtcccctatg |
45664367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 45680129 - 45680177
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||| |||| |
|
|
| T |
45680129 |
ttgcggttatggacccctaactaatttaaatacaaaacagacccttatg |
45680177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 45680365 - 45680317
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| | |||||| |
|
|
| T |
45680365 |
ttgcggttatggacccctaactaatttaaatacaaaacagtctcctatg |
45680317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 47764129 - 47764177
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||| |||||| |
|
|
| T |
47764129 |
ttgcggttatggacccctaattaatttaaatacaaaacagccacctatg |
47764177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 52143440 - 52143392
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| || ||||| |
|
|
| T |
52143440 |
ttgcggttatggacccctaactaatttaaatacaaaacagacctctatg |
52143392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 276 - 319
Target Start/End: Complemental strand, 1480520 - 1480477
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccc |
319 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
1480520 |
ttgcggttatggatccctaactaatttaaatacaaaacagcccc |
1480477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 276 - 319
Target Start/End: Original strand, 12071682 - 12071725
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccc |
319 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12071682 |
ttgcggttatggactcctaactaatttaaatacaaaacagcccc |
12071725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 276 - 319
Target Start/End: Complemental strand, 25098405 - 25098363
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccc |
319 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
25098405 |
ttgcggttatggacc-ctaactaatttaaatacaaaacagcccc |
25098363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 274 - 324
Target Start/End: Complemental strand, 20288025 - 20287975
Alignment:
| Q |
274 |
aattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| |||||||||| | ||||||||||||||||||||||| ||||||||| |
|
|
| T |
20288025 |
aattacggttatggatccctaactaatttaaatacaaaacaaccccctatg |
20287975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 274 - 324
Target Start/End: Original strand, 52254526 - 52254576
Alignment:
| Q |
274 |
aattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||| || ||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
52254526 |
aattgcgattttggccctctaactaattaaaatacaaaacagccccctatg |
52254576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 276 - 317
Target Start/End: Original strand, 18589887 - 18589928
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcc |
317 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
18589887 |
ttgcggttatggtcccctaactaatttaaatacaaaacagcc |
18589928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 276 - 321
Target Start/End: Complemental strand, 22204581 - 22204536
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccct |
321 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
22204581 |
ttgcggttatggactcctaattaatttaaatacaaaacagccccct |
22204536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 276 - 317
Target Start/End: Complemental strand, 42589677 - 42589636
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcc |
317 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
42589677 |
ttgcggttatggccccctaactaatttaaatacaaaacagcc |
42589636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 1712408 - 1712456
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| || ||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1712408 |
ttgcgattttggccctctaactaattaaaatacaaaacagccccctatg |
1712456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 320
Target Start/End: Complemental strand, 2371452 - 2371408
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccc |
320 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||| ||||| |
|
|
| T |
2371452 |
ttgcggttatggacccctaaataatttaaatacaaaacaaccccc |
2371408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 268 - 324
Target Start/End: Complemental strand, 3264284 - 3264228
Alignment:
| Q |
268 |
aggcttaattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || |||||| ||||||||||||||||||||||| ||| ||||| |
|
|
| T |
3264284 |
aggcttaattgcacttttggacccctaactaatttaaatacaaaacaaccctctatg |
3264228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 3384002 - 3384050
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| | || |||||||||||||||||||||||||||| |||| |
|
|
| T |
3384002 |
ttgcggttattgccccctaactaatttaaatacaaaacagccccatatg |
3384050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 6491454 - 6491502
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||| ||||| |||||||||||||||| |||||||||| |
|
|
| T |
6491454 |
ttgcggttatgaacccctaacaaatttaaatacaaaacggccccctatg |
6491502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 8029232 - 8029184
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| |||||||| | |||||||||||||||||||||||| |||||||| |
|
|
| T |
8029232 |
ttgcagttatggatccctaactaatttaaatacaaaacagtcccctatg |
8029184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 9058426 - 9058394
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
9058426 |
ctaactaatttaaatacaaaacagccccctatg |
9058394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 12071920 - 12071872
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||| |||| |||| |
|
|
| T |
12071920 |
ttgcggttatagacccctaactaatttaaatacaaaacaaccccttatg |
12071872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 20017652 - 20017604
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| |||||||| ||||||||||||||||| ||||||| |||||||| |
|
|
| T |
20017652 |
ttgcgtttatggacttctaactaatttaaatataaaacagtcccctatg |
20017604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 23208581 - 23208533
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||| ||||| |||| ||||||||||||||||||||||| |||| |
|
|
| T |
23208581 |
ttgcggttacggacccctaattaatttaaatacaaaacagccccttatg |
23208533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 26434965 - 26434917
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||| ||||||||||| |
|
|
| T |
26434965 |
ttgcggttatgaccccctaactaatttaaatacaaaatagccccctatg |
26434917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 33871155 - 33871123
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
33871155 |
ctaactaatttaaatacaaaacagccccctatg |
33871123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 40618768 - 40618815
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||| |||| |
|
|
| T |
40618768 |
ttgcggttatggccc-ctaactaatttaaatacaaaacagccccttatg |
40618815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 40815141 - 40815093
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||| |||||||| |
|
|
| T |
40815141 |
ttgcggttatggctccctaactaatttaaatacaaaacagtcccctatg |
40815093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 45012670 - 45012718
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| | || |||||||||||||||||||||||| |||||||| |
|
|
| T |
45012670 |
ttgcggttatagccccctaactaatttaaatacaaaacagacccctatg |
45012718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 46320714 - 46320762
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||| |||||||||||| |
|
|
| T |
46320714 |
ttgcggttatggatccataactaatttaaatacaaatcagccccctatg |
46320762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 49227158 - 49227206
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||| | |||||| |
|
|
| T |
49227158 |
ttgcggttatggacccctaactaatttatatacaaaacagtctcctatg |
49227206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 260 - 324
Target Start/End: Complemental strand, 51463160 - 51463096
Alignment:
| Q |
260 |
taaaaaataggcttaattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||||||||||| || || || |||| ||||| |||||||||||||||||||||| |
|
|
| T |
51463160 |
taaaaaataggcttaattgcacttttgaccccctaattaattaaaatacaaaacagccccctatg |
51463096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 51549416 - 51549368
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| || |||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
51549416 |
ttgcgattttggacccctaactaattaaaatacaaaacagccccctatg |
51549368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 276 - 323
Target Start/End: Complemental strand, 4243402 - 4243356
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
||||||||||||| | ||||||||||||||| |||||||||||||||| |
|
|
| T |
4243402 |
ttgcggttatggatc-ctaactaatttaaatgcaaaacagccccctat |
4243356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 276 - 323
Target Start/End: Complemental strand, 10279952 - 10279906
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
|||||||||||| ||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
10279952 |
ttgcggttatggtcct-taattaatttaaatacaaaacagccccctat |
10279906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 276 - 323
Target Start/End: Original strand, 22071201 - 22071248
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||||| ||||| |
|
|
| T |
22071201 |
ttgcggttatggacccataactaatttaaatataaaacagcctcctat |
22071248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 276 - 319
Target Start/End: Original strand, 52233469 - 52233512
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccc |
319 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||| |||| |
|
|
| T |
52233469 |
ttgcggttatggccccctaactaatttaaatacaaaacaacccc |
52233512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 276 - 323
Target Start/End: Complemental strand, 52363454 - 52363407
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
||||||||||| ||| |||||||||||||||| ||||||||| ||||| |
|
|
| T |
52363454 |
ttgcggttatgaacccctaactaatttaaataaaaaacagcctcctat |
52363407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 266 - 324
Target Start/End: Original strand, 41003602 - 41003660
Alignment:
| Q |
266 |
ataggcttaattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| ||||||||| || ||| || |||||||||| |||||||||||||||||||||| |
|
|
| T |
41003602 |
atagacttaattgcacttttggccccctaactaattaaaatacaaaacagccccctatg |
41003660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 276 - 314
Target Start/End: Complemental strand, 47764366 - 47764328
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaaca |
314 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
47764366 |
ttgcggttatggactcctaactaatttaaatacaaaaca |
47764328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #169
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 276 - 314
Target Start/End: Complemental strand, 52233687 - 52233649
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaaca |
314 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
52233687 |
ttgcggttatggtcccctaactaatttaaatacaaaaca |
52233649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #170
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 324
Target Start/End: Original strand, 6742846 - 6742911
Alignment:
| Q |
259 |
ttaaaaaataggcttaattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||| ||||||||||| || |||||| |||| ||||| |||||||||||| ||||||||| |
|
|
| T |
6742846 |
ttaaaaaaatggcttaattgcacttttggacccctaattaattaaaatacaaaacaaccccctatg |
6742911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #171
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 267 - 324
Target Start/End: Complemental strand, 29704900 - 29704843
Alignment:
| Q |
267 |
taggcttaattgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||| |||||||| || ||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
29704900 |
taggtttaattgcacttttggactcctaactaatttaaatacaaaacagcctcctatg |
29704843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #172
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 276 - 317
Target Start/End: Complemental strand, 43670589 - 43670548
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcc |
317 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||| |||| |
|
|
| T |
43670589 |
ttgcggttatggccccctaactaatttaaatacaaaatagcc |
43670548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #173
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 6606959 - 6606927
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
6606959 |
ctaactaattaaaatacaaaacagccccctatg |
6606927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #174
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 21931811 - 21931843
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
21931811 |
ctaactaattaaaatacaaaacagccccctatg |
21931843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #175
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 24183118 - 24183150
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
24183118 |
ctaactaattaaaatacaaaacagccccctatg |
24183150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #176
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 26063974 - 26064006
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
26063974 |
ctaactaattaaaatacaaaacagccccctatg |
26064006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #177
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 32038110 - 32038066
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||| || |||||||| |
|
|
| T |
32038110 |
ggttatagacccctaactaatttaaatacaaaatagtcccctatg |
32038066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #178
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 33811685 - 33811653
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
33811685 |
ctaactaatttaaatacaaaacaaccccctatg |
33811653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #179
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 35580928 - 35580896
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
35580928 |
ctaactaattaaaatacaaaacagccccctatg |
35580896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #180
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 42589458 - 42589506
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||||| |||||||||| || ||||| |
|
|
| T |
42589458 |
ttgcggttatggccccctaactaatttaattacaaaacagacctctatg |
42589506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #181
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 46038954 - 46038986
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
46038954 |
ctaactaattaaaatacaaaacagccccctatg |
46038986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #182
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 50504751 - 50504719
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
50504751 |
ctaactaattaaaatacaaaacagccccctatg |
50504719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #183
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 320
Target Start/End: Original strand, 51462218 - 51462262
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccc |
320 |
Q |
| |
|
||||| || ||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
51462218 |
ttgcgattttggacctctaactaattaaaatacaaaaaagccccc |
51462262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1067 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 2)
Name: scaffold1067
Description:
Target: scaffold1067; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 1611 - 1563
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
1611 |
ttgcggttatggccccctaactaatttaaatacaaaacagccccctatg |
1563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1067; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 1393 - 1441
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||| |||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
1393 |
ttgcggtcatggccccctaactaatttaaatacaaaacagccccctatg |
1441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0864 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 2)
Name: scaffold0864
Description:
Target: scaffold0864; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 2916 - 2872
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2916 |
ggttatggacccctaactaatttaaatacaaaacagccccctatg |
2872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0864; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 280 - 312
Target Start/End: Original strand, 2686 - 2718
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaa |
312 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
2686 |
ggttatggacccctaactaatttaaatacaaaa |
2718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0777 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold0777
Description:
Target: scaffold0777; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 145 - 97
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
145 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccttatg |
97 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0693 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold0693
Description:
Target: scaffold0693; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 4579 - 4627
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4579 |
ttgcgtttatggccctctaactaatttaaatacaaaacagccccctatg |
4627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0594 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 2)
Name: scaffold0594
Description:
Target: scaffold0594; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 5630 - 5678
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5630 |
ttgcggttatgaacccctaactaatttaaatacaaaacagccccctatg |
5678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0594; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 5868 - 5820
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||| ||||||||| |
|
|
| T |
5868 |
ttgcggttatggaccccttactaatttaaatacaaaacaaccccctatg |
5820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 4)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 10666 - 10714
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10666 |
ttgcgattatggacccctaactaatttaaatacaaaacagccccctatg |
10714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 10903 - 10855
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
10903 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccttatg |
10855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 15956 - 16004
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
15956 |
ttgcgattatggacccctaactaatttaaatacaaaacagccccctatg |
16004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 16193 - 16145
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
16193 |
ttgcggttatggacccctaactaatttaaatacaaaacagccccttatg |
16145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0352 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 2)
Name: scaffold0352
Description:
Target: scaffold0352; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 9985 - 10033
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
9985 |
ttgcggttatggacccctaactaatttaaatacaaaacagcctcctatg |
10033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0352; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 10212 - 10164
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
10212 |
ttgcggttatggatccctaactaatttaaatacaaaacagccccctatg |
10164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0328 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 2)
Name: scaffold0328
Description:
Target: scaffold0328; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 15812 - 15860
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
15812 |
ttgcggttatggccctctaactaatttaaatacaaaacagtcccctatg |
15860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0328; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 16029 - 15981
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
16029 |
ttgcggttatggccccctaactaatttaaatacaaaacagccccctatg |
15981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0227 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 2)
Name: scaffold0227
Description:
Target: scaffold0227; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 1022 - 974
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
1022 |
ttgcggttatggacctctaactaatttaaatataaaacagcctcctatg |
974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0227; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 320
Target Start/End: Original strand, 801 - 845
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccc |
320 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
801 |
ttgcggttacggacccctaactaatttaaatacaaaacagccccc |
845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0182 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 3)
Name: scaffold0182
Description:
Target: scaffold0182; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 20633 - 20681
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
20633 |
ttgcggttatgaacccctaactaatttaaatacaaaacagccccctatg |
20681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0182; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 276 - 319
Target Start/End: Complemental strand, 20889 - 20846
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccc |
319 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
20889 |
ttgcggttatggacccttaactaatttaaatacaaaacagcccc |
20846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0182; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 12085 - 12134
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacag-ccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||| || ||||||||| |
|
|
| T |
12085 |
ttgcggttatggacccctaattaatttaaatacaaaatagtccccctatg |
12134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 2)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 20664 - 20712
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
20664 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccctatg |
20712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 20901 - 20853
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||| |||| |
|
|
| T |
20901 |
ttgcggttatggacccctaactaatttaaatacaaaacaaccccatatg |
20853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 3)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 238664 - 238708
Alignment:
| Q |
280 |
ggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
238664 |
ggttatggacccctaactaatttaaatacaaaacagccccctatg |
238708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 276 - 318
Target Start/End: Complemental strand, 238899 - 238857
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccc |
318 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
238899 |
ttgcggttatgtacccctaactaatttaaatacaaaacagccc |
238857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 22828 - 22876
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| || |||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
22828 |
ttgcgattttggacccctaactaattaaaatacaaaacagccccctatg |
22876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: scaffold0121
Description:
Target: scaffold0121; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 276 - 323
Target Start/End: Original strand, 22333 - 22380
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
22333 |
ttgcggttatggccccctaactaatttaaatacaaaacagccccctat |
22380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 276 - 323
Target Start/End: Complemental strand, 22551 - 22504
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
22551 |
ttgcggttatggccccctaactaatttaaatacaaaacagccccctat |
22504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 3)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 276 - 323
Target Start/End: Original strand, 75148 - 75195
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctat |
323 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
75148 |
ttgccgttatggacccctaactaatttaaatacaaaacagccccctat |
75195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 75350 - 75302
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||| ||||||||||| |
|
|
| T |
75350 |
ttgcggttatggatccctaactaatttaaatacaaaagagccccctatg |
75302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 199722 - 199754
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
199722 |
ctaactaattaaaatacaaaacagccccctatg |
199754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 276 - 322
Target Start/End: Original strand, 3820 - 3866
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccccta |
322 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
3820 |
ttgcggttatggaaccctaactaatttaaatacaaaacagcccccta |
3866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0272 (Bit Score: 37; Significance: 0.000000000008; HSPs: 4)
Name: scaffold0272
Description:
Target: scaffold0272; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 10836 - 10788
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| | |||||| |
|
|
| T |
10836 |
ttgcggttatggacccctaactaatttaaatacaaaacagtctcctatg |
10788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0272; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 20906 - 20954
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| | || ||||||||||||||||||||||||||||||||| |
|
|
| T |
20906 |
ttgcggttatagccccctaactaatttaaatacaaaacagccccctatg |
20954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0272; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 283 - 324
Target Start/End: Original strand, 10604 - 10645
Alignment:
| Q |
283 |
tatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
10604 |
tatggacctttaactaatttaaatacaaaacagccccttatg |
10645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0272; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 21124 - 21076
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||||| |||| || ||||||||||||||||||||||| |||| |||| |
|
|
| T |
21124 |
ttgcggtaatggccccctaactaatttaaatacaaaacaaccccttatg |
21076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0154
Description:
Target: scaffold0154; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 26301 - 26350
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaata-caaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || |||||||||||||||| ||||||||||||||||| |
|
|
| T |
26301 |
ttgcggttatggccccctaactaatttaaataccaaaacagccccctatg |
26350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0213 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: scaffold0213
Description:
Target: scaffold0213; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 21104 - 21152
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| |||||| || ||||||||||||||||||||||||||| ||||| |
|
|
| T |
21104 |
ttgcgattatggccccctaactaatttaaatacaaaacagccctctatg |
21152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0213; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 21322 - 21274
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||| || |||||||| |
|
|
| T |
21322 |
ttgcggttatggccccctaactaatttaaatacaaaagagtcccctatg |
21274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0032 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0032
Description:
Target: scaffold0032; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 276 - 322
Target Start/End: Original strand, 16557 - 16603
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagcccccta |
322 |
Q |
| |
|
||||||||||| || | ||||||||||||||| |||||||||||||| |
|
|
| T |
16557 |
ttgcggttatgcacttttaactaatttaaatataaaacagcccccta |
16603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1171 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold1171
Description:
Target: scaffold1171; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 276 - 324
Target Start/End: Original strand, 857 - 904
Alignment:
| Q |
276 |
ttgcggttatggacctctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
||||| ||||||||| | |||||||||||||||||||| |||||||||| |
|
|
| T |
857 |
ttgcgtttatggaccccaaactaatttaaatacaaaac-gccccctatg |
904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0854 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0854
Description:
Target: scaffold0854; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 1897 - 1929
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
1897 |
ctaactaattaaaatacaaaacagccccctatg |
1929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0047 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0047
Description:
Target: scaffold0047; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 63323 - 63291
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
63323 |
ctaactaattaaaatacaaaacagccccctatg |
63291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 29; Significance: 0.0000004; HSPs: 2)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Original strand, 32033 - 32065
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
32033 |
ctaactaattaaaatacaaaacagccccctatg |
32065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 32269 - 32237
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
32269 |
ctaactaattaaaatacaaaacagccccctatg |
32237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0019 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 122589 - 122557
Alignment:
| Q |
292 |
ctaactaatttaaatacaaaacagccccctatg |
324 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
122589 |
ctaactaattaaaatacaaaacagccccctatg |
122557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University