View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18195_high_39 (Length: 240)
Name: NF18195_high_39
Description: NF18195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18195_high_39 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 18 - 218
Target Start/End: Original strand, 45707684 - 45707884
Alignment:
| Q |
18 |
aggtaggaaaacaggaagcagaaaacagaaattacagctaaaaacagaagctgatgctgttttatgcaaaaactgacagcaaaccaaaccaaaaaccgca |
117 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45707684 |
aggtaggaaaacaggaagcagaaagcagaaattatagctaaaaacagaagctgatgctgttttatgcaaaaactgacagcaaaccaaaccaaaaaccgca |
45707783 |
T |
 |
| Q |
118 |
taccccagcctcagcctcaaaaactcagcctaacacagctcctctaccttaactagcactgctgttacatatgttgatttcataaagagtggcattgtga |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45707784 |
taccccagcctcagcctcaaaaactcagcctaacacagctcctctaccttaacaagcactgctgttacatatgttgttttcataaagagtggcattgtga |
45707883 |
T |
 |
| Q |
218 |
a |
218 |
Q |
| |
|
| |
|
|
| T |
45707884 |
a |
45707884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University