View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18195_low_16 (Length: 443)
Name: NF18195_low_16
Description: NF18195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18195_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 2e-81; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 2e-81
Query Start/End: Original strand, 17 - 226
Target Start/End: Original strand, 23282660 - 23282872
Alignment:
| Q |
17 |
atcaacttgtcatgtttatattcaataggaagggctacttgttgaacaagaaatctcatattagggaaagctgcttgaactacttgaggaatgttcc--a |
114 |
Q |
| |
|
||||||||||||| ||||| ||||||| |||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| | |
|
|
| T |
23282660 |
atcaacttgtcatatttatcttcaataagaagggttacttgttgaacaagaaatctcatattagggaaagctacttgaactacttgagggatgttccata |
23282759 |
T |
|
| Q |
115 |
ttgaccttcatgaataaaattagcaattg-ttgcagtaaggttttgagagacatgttgtggcaaattaagagtgattgatcgaggatatgcacaccatgc |
213 |
Q |
| |
|
|||||||||||||||||||||||||| || ||| ||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23282760 |
ttgaccttcatgaataaaattagcaactgtttggagtgaggttttgagagacatgttgtggaaaattaagagtgattgatcgaggatatgcacaccatgc |
23282859 |
T |
|
| Q |
214 |
atcattccaaaat |
226 |
Q |
| |
|
||||||||||||| |
|
|
| T |
23282860 |
atcattccaaaat |
23282872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 224 - 276
Target Start/End: Original strand, 23253091 - 23253143
Alignment:
| Q |
224 |
aattcaagcatagaagtattcaatcaatgacaactttctttaagagtattaga |
276 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||||| ||| ||||||| |
|
|
| T |
23253091 |
aattcaagcatagaaacattcaatcaatgataactttctttgagaatattaga |
23253143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 368 - 423
Target Start/End: Original strand, 23253159 - 23253212
Alignment:
| Q |
368 |
atattttggtttctatgaatgctcatataaaattattgctctcctactttaacctt |
423 |
Q |
| |
|
||||||||||||||||||||||| |||||| |||||||||||| |||||||||| |
|
|
| T |
23253159 |
atattttggtttctatgaatgct--aataaaactattgctctcctcctttaacctt |
23253212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University