View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18195_low_35 (Length: 319)
Name: NF18195_low_35
Description: NF18195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18195_low_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 1 - 181
Target Start/End: Complemental strand, 14130057 - 14129879
Alignment:
| Q |
1 |
tctacagaattcacgtatgtaattaaaatggacaaaatgtatcgtttaatccacacctttaaatatttcagttgaacattgtatttata-ttatatggat |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
14130057 |
tctacagaattcacgtatgtaattaaaatgaacaaaatgtatcgtttaatccacaccattaaatattttagttgaacattgtatttataattatatggat |
14129958 |
T |
 |
| Q |
100 |
taatatttaatgattcgagaatgttaaattaagtatggtagaggccactttatggtttagtaggaactcagtgagataatta |
181 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14129957 |
ta---tttaatgattcgagaatgttaaattaagtatggtagaggccactttatggtttagtaggaactcagtgagataatta |
14129879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University