View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18195_low_49 (Length: 246)
Name: NF18195_low_49
Description: NF18195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18195_low_49 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 9 - 228
Target Start/End: Complemental strand, 51112245 - 51112028
Alignment:
| Q |
9 |
agcagagatgattcaaatatataagaatgaatgggcatgaaactcaaaatatgaaagacgacgggcttcttttgaagtcttgaatccttcaatgtttttg |
108 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
51112245 |
agcagaaatgattcaaatatataagaatgaatgggcatgaaactcaaaatatgaaagacgacgggcttcttttgaagtc-tgaacccttcaatgtttttg |
51112147 |
T |
 |
| Q |
109 |
agtccgagtcggatcacatcaagagtctagtttaaaattaatgttttgatcaagaattgaagtgtgagataatttttcgtctatctagagtagtaaaata |
208 |
Q |
| |
|
||||||||||| ||||||| |||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51112146 |
agtccgagtcgaatcacattaagaatctagtttaaaattaatgttttgat-aagaattgaagtgtgagataatttttcgtctatctagagtagtaaaata |
51112048 |
T |
 |
| Q |
209 |
ataataaaattaagtgaaat |
228 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
51112047 |
ataataaaattaagtgaaat |
51112028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University