View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18195_low_50 (Length: 243)
Name: NF18195_low_50
Description: NF18195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18195_low_50 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 8 - 223
Target Start/End: Complemental strand, 22619232 - 22619017
Alignment:
| Q |
8 |
gacatcatcagctttgtctccaacattgctatgttcgttccattcaccttttgcctcaaaatcatcactctatcatctccaatggcacataccaaaacag |
107 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22619232 |
gacatcaacagctttgtctccaacattgctatgttcattccattcacctttggcctcaaaatcatcactctatcatctccaatggcacataccaaaacag |
22619133 |
T |
 |
| Q |
108 |
gttcacaatcactaccctttcagctccatcaattcactctcttctgcaaaaccactcgttctttccaattccagaagaacccacttgtgctccgcaggtc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22619132 |
gttcacaatcactaccctttcagctccatcaattcactctcttctgcaaaaccactcgttctttccaattccagaagaacccacttgtgctccgcaggtc |
22619033 |
T |
 |
| Q |
208 |
gacgcaaatccacaga |
223 |
Q |
| |
|
|||||||| ||||||| |
|
|
| T |
22619032 |
gacgcaaacccacaga |
22619017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University