View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18196_high_21 (Length: 390)

Name: NF18196_high_21
Description: NF18196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18196_high_21
NF18196_high_21
[»] chr1 (1 HSPs)
chr1 (192-374)||(52874332-52874514)


Alignment Details
Target: chr1 (Bit Score: 179; Significance: 2e-96; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 192 - 374
Target Start/End: Original strand, 52874332 - 52874514
Alignment:
192 catatatttctattagattcctttttgcacgagatttacaattggttgattttaaattgcccatttcagtggaagttctactatatgctccaactcgtcc 291  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
52874332 catatatttctattagattcctttttgcacgagatttacaattggttgattttgaattgcccatttcagtggaagttctactatatgctccaactcgtcc 52874431  T
292 aactatagatttctctgttggatgtttgtggttgatgtctgtcggaacagttatatgtgcttcgttatggtcagacttaactg 374  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52874432 aactatagatttctctgttggatgtttgtggttgatgtctgtcggaacagttatatgtgcttcgttatggtcagacttaactg 52874514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University