View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18196_high_34 (Length: 315)
Name: NF18196_high_34
Description: NF18196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18196_high_34 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 57; Significance: 8e-24; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 210 - 313
Target Start/End: Complemental strand, 29822715 - 29822610
Alignment:
| Q |
210 |
tggaatgtagttggggggtaaagcgtggcaataccataatcatccnnnnnnnnnn--ggagatagatatgtgacctcaggatgatcagttagttgagttt |
307 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29822715 |
tggaatgtaggtgggggataaagcgtggcaataccataatcatccaaaaaaaaaaaaggagatagatatgtgacctcaggatgatcagttagttgagttt |
29822616 |
T |
|
| Q |
308 |
cacctt |
313 |
Q |
| |
|
|||||| |
|
|
| T |
29822615 |
cacctt |
29822610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 11 - 76
Target Start/End: Complemental strand, 29822986 - 29822920
Alignment:
| Q |
11 |
atgaagtcgattttaatgaactcaattgtgccacataagttctatatcattaaaa-aggtagaggtc |
76 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
29822986 |
atgaagtcgattttaatgaactcaattgtgccacataaattctatatcattaaaagaggtagaggtc |
29822920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University