View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18196_high_38 (Length: 302)
Name: NF18196_high_38
Description: NF18196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18196_high_38 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 77 - 285
Target Start/End: Complemental strand, 54729265 - 54729057
Alignment:
| Q |
77 |
ccaacattcatgatgtcaatcttatgtcatttcttttggaaaactagtaattccactagataaccgtttatcaaccacagattcctattcgggtacaaat |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54729265 |
ccaacattcatgatgtcaatcttatgtcatttcttttgaaaaactagtaattccactagataaccgtttatcaaccacagattcctattcgggtacaaat |
54729166 |
T |
|
| Q |
177 |
agcagcatataccgtttattattctactttgacaaaatgaataaattattcaccttgcttctcacaagtagaataataaacactgttgagaactactacg |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54729165 |
agcagcatataccgtttattattctactttgacaaaatgaataaattattcaccttgcttctgacaagtagaataataaacactgttgagaactactacg |
54729066 |
T |
|
| Q |
277 |
ctcattcat |
285 |
Q |
| |
|
|||||||| |
|
|
| T |
54729065 |
atcattcat |
54729057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 23 - 61
Target Start/End: Complemental strand, 54729358 - 54729320
Alignment:
| Q |
23 |
ataatccctacatcatgaatgtaataaaataaccgttga |
61 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
54729358 |
ataagccctacatcatgaatgtaataaaataactgttga |
54729320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University