View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18196_high_49 (Length: 266)
Name: NF18196_high_49
Description: NF18196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18196_high_49 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 17 - 259
Target Start/End: Complemental strand, 19683721 - 19683480
Alignment:
| Q |
17 |
agaaggtacattttggttaaccatagaaaaagctttcagctttctatgagcaacaatatggttaaagggttatgttggagtgataatgaaggaatcaatg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
19683721 |
agaaggtacattttggttaaccatagaaaaagctttcagctttctatgagcaacaacatggttaaagggttatgttggaatgataatgaaggaatcaatg |
19683622 |
T |
 |
| Q |
117 |
gtgatacaaaagtagagaaatgggtcttgtgtgctaaacatggttgaggaatttcatcaaacagtttctatgcactatctttgcaccttctgcaaacatc |
216 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19683621 |
gtgatacaaaagtagagaaatgggttttgtgtgctaaacatggttgaggaatttcatcaaacagtttctatgcactatctttgcaccttctgcaaacatc |
19683522 |
T |
 |
| Q |
217 |
gattcctacagaaaaatcttcatggaatgaagaatgatgatgt |
259 |
Q |
| |
|
| ||| |||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
19683521 |
g-ttcgtacagaaaaaacttcttggaatgaagaatgatgatgt |
19683480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University