View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18196_high_59 (Length: 232)

Name: NF18196_high_59
Description: NF18196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18196_high_59
NF18196_high_59
[»] chr5 (1 HSPs)
chr5 (1-220)||(33915582-33915803)


Alignment Details
Target: chr5 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 33915803 - 33915582
Alignment:
1 ggccttatcaactgtcgatgaaatttagagcaatataaatgacaatggttactctgatgattatgcagcaatataaacgggaatgtgtagcagcatgttg 100  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
33915803 ggccttatcaactgttgatgaaatttagagcaatataaatgacaatggttactctgatgattatgcagcaatataaatgggaatgtgtagcagcatgttg 33915704  T
101 acaaaggccctagacattgctctcaactactaggagacatcttggaaagatagatcttgagtcaaatggattttagtttcaatcttgtttcatgaaactg 200  Q
    || |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||    
33915703 ac-aaggcccttgacattgctctcaactactaggagacatcttggaaagatagatcttgagtcaaatggcttttagtttcaatcttgtatcatgaaactg 33915605  T
201 tgt---tgccatccttaattttg 220  Q
    |||   |||||||||||||||||    
33915604 tgttgatgccatccttaattttg 33915582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University