View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18196_high_63 (Length: 203)
Name: NF18196_high_63
Description: NF18196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18196_high_63 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 1e-70; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 1e-70
Query Start/End: Original strand, 21 - 186
Target Start/End: Original strand, 16330730 - 16330896
Alignment:
| Q |
21 |
gtcgttacccccggtcactagcttatcactcaccagagggtccaaccaatatttattattcacatcgcttccatcctaggcttttgttatcacctttctc |
120 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
16330730 |
gtcgttacccctggtcactagcttatcactcaccagagggtccaacgaatatttattattcacaccgcttccatcctaggctttagttatcacctttctc |
16330829 |
T |
 |
| Q |
121 |
ttggtattccgaacatcaccaaaagtat-ttcattggggccatgcacctctttaacttaagaatatt |
186 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
16330830 |
ttggtattccgaacatcaccaaaagtatcaccattggggccatgcacctctttaacttaagaatatt |
16330896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 24 - 64
Target Start/End: Original strand, 16339915 - 16339955
Alignment:
| Q |
24 |
gttacccccggtcactagcttatcactcaccagagggtcca |
64 |
Q |
| |
|
|||||||||| |||||||||||||||| || |||||||||| |
|
|
| T |
16339915 |
gttacccccgatcactagcttatcacttactagagggtcca |
16339955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University